The bisulfite-treated DNA samples were amplified for 40 cycles by polymerase chain reaction (PCR) using the LINE-1 forward (5'–CCGTAAGGGGTTAGGGAGTTTTT–3') and LINE-1 reverse (5'–RTAAAACC CTCCRAACCAAATATAAA–3') primers at an annealing temperature of 50℃. After PCR, the LINE-1 amplicons (160 bp in length) were digested with TagI and TasI restriction enzymes in NEB buffer 3 (New England Biolabs, Ipswich, MA, USA) at 65℃ overnight. The digested PCR products were then run on an 8% non-denaturing polyacrylamide gel and stained with SYBR green nucleic acid gel stain (Gelstar, Lonza, Allendale, NJ, USA). The intensities of both COBRA-PCR fragments were quantified using a phosphorimager with ImageQuant Software (Molecular Dynamics, GE Healthcare, Slough, UK). Distilled water was used as a negative control. DNA samples from HeLa, Jurkat, and Daudi cell lines were used as positive controls in each experiment as well as for inter-assay variability normalisation. All samples were performed in duplicate.
Neb buffer 3
Manufactured by New England Biolabs
Sourced in United States
NEB Buffer 3 is a buffer solution designed for use in various molecular biology applications. It is a component of several restriction enzyme digestion and other DNA manipulation protocols. The buffer's core function is to provide an optimal chemical environment to facilitate the activity of specific enzymes.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green nucleic acid gel stain, by Lonza (1 mentions)
Lambda phosphatase, by New England Biolabs (1 mentions)
Protein metallophosphatase buffer, by New England Biolabs (1 mentions)
Calf intestinal phosphatase, by New England Biolabs (1 mentions)
Noti enzyme, by New England Biolabs (1 mentions)
Bovine serum albumin (bsa), by New England Biolabs (1 mentions)
Ecori, by New England Biolabs (1 mentions)
Typhoon fla 9500, by GE Healthcare (1 mentions)
Sybr gold, by Thermo Fisher Scientific (1 mentions)
Geneampdntp blend, by Thermo Fisher Scientific (1 mentions)
Apoi enzyme, by New England Biolabs (1 mentions)
Cytidine, by Merck Group (1 mentions)
Guanosine, by Merck Group (1 mentions)
Alkaline phosphatase, by New England Biolabs (1 mentions)
Adenosine, by Merck Group (1 mentions)
Deoxyadenosine, by Merck Group (1 mentions)
Uridine, by Merck Group (1 mentions)
Rnase if, by New England Biolabs (1 mentions)
Cutsmart buffer, by New England Biolabs (1 mentions)
Ammonium acetate, by Merck Group (1 mentions)
13 protocols using neb buffer 3
1
Quantitative Analysis of LINE-1 Methylation
2
Dephosphorylation of Neuronal Proteins
3
Cas9n-mediated DNA Labeling and Linearization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gRNAs or sgRNAs(5 μM) were incubated with 600 ng of Cas9n D10A (PNA Bio Inc), 1X NEB Buffer 3 and 1X BSA (NEB) at 37°C for 15 min. The DNA (500ng) was added to the mixture and incubated at 37°C for 60 min. The nicked DNA was then labeled with 4.12 units of DNA Taq Polymerase (NEB), 0.1 μM of ATTO- 532 dUTP dAGC and 1X Thermopol Buffer (NEB) at 72°C 60 min. The labeled fosmids and BACs were cut and linearized with 5 units of NotI enzyme (NEB) at 37°C for 60 min. The labeled pecoHIV-NL4–3-eLuc plasmid (17,099 bp) was digested with 20 units of a unique restriction enzyme EcoRI (at 5744 bp) (NEB). NotI and EcoRI were inactivated at 65°C for 20 min.
4
Synthesis and Characterization of 5'-Thiamine RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5′-Monophosphate RNA (20 nt, see Supplementary Table S1 ) (10 µM, 0.5 nmol) was incubated in the presence of 10 mM ImppTh and 10 mM MgCl2 at 50 °C for 1 h. Then, a second addition of ImppTh was performed, increasing the concentration to 20 mM, followed by further incubation at 50 °C for 1 h. Modified and unmodified RNA was purified via ethanol precipitation and 0.2 nmol of RNA were further incubated in the presence of 1 U Xrn1 (New England BioLabs Inc., Ipswich, MA, USA) in 1 X NEB buffer 3 (New England BioLabs Inc., Ipswich, MA, USA) at 37 °C for 2 h. RNA was purified from Xrn1 by phenol-chloroform and ether extraction, followed by ethanol precipitation. Samples of the reaction with ImppTh and Xrn1 digest were analyzed by 20% denaturing PAGE and RNA bands visualized on a Typhoon FLA 9500 biomolecular imager (GE Healthcare, Chicago, IL, USA) upon staining with SYBR Gold (Invitrogen, Carlsbad, CA, USA). ESI-MS analysis was conducted to validate the identity of 5′-thiamine RNA.
5
Genotyping of rs613872 Polymorphism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR followed by digestion with restriction enzyme was performed for rs613872 where the ‘T’ nucleotide created a restriction site for enzyme ApoI. The presence of ‘T’ allele cut the 230 bp PCR amplified product into 117 bp and 113 bp fragments.
First, a 20 μL reaction was set up containing 10 mM Tris (pH 9.0), 50 mM KCl, 1.5 mM MgCl2 and 0.01% gelatin, 200 μM of dNTP blend (GeneAmpdNTP blend, Applied Biosystems, Foster City, CA, USA), 5 μM of each forward and reverse primer (Sigma-Aldrich, St. Louis, MO, USA) (forward primer-5’ CAGGCACTCCCCATTTACTG 3’, reverse primer-5’ ACCCCAGTAGGGTTGTGATG 3’), 1U of Taq DNA polymerase (GeNei, Bangalore, India), and 100 ng of genomic DNA. A touchdown PCR with annealing temperature of 61.3°C–54.3°C was performed.
Twenty μL restriction digestion reaction was set up with 5 μL of amplified product, 2 μL of NEB buffer 3 (New England BioLabsInc, MA, USA.), 1 μL of 100X BSA, 1U of ApoI enzyme (New England BioLabs Inc., MA, USA). The reaction was incubated at 50°C for 16 h followed by heat inactivation of the enzyme at 80°C for 20 min. The amplified, digested products were analyzed on a 2% agarose gel. To eliminate the possibility of incomplete digestion, overnight restriction digestion protocol was performed, and samples were sequenced at random by Sanger DNA sequencing to confirm the genotype.
First, a 20 μL reaction was set up containing 10 mM Tris (pH 9.0), 50 mM KCl, 1.5 mM MgCl2 and 0.01% gelatin, 200 μM of dNTP blend (GeneAmpdNTP blend, Applied Biosystems, Foster City, CA, USA), 5 μM of each forward and reverse primer (Sigma-Aldrich, St. Louis, MO, USA) (forward primer-5’ CAGGCACTCCCCATTTACTG 3’, reverse primer-5’ ACCCCAGTAGGGTTGTGATG 3’), 1U of Taq DNA polymerase (GeNei, Bangalore, India), and 100 ng of genomic DNA. A touchdown PCR with annealing temperature of 61.3°C–54.3°C was performed.
Twenty μL restriction digestion reaction was set up with 5 μL of amplified product, 2 μL of NEB buffer 3 (New England BioLabsInc, MA, USA.), 1 μL of 100X BSA, 1U of ApoI enzyme (New England BioLabs Inc., MA, USA). The reaction was incubated at 50°C for 16 h followed by heat inactivation of the enzyme at 80°C for 20 min. The amplified, digested products were analyzed on a 2% agarose gel. To eliminate the possibility of incomplete digestion, overnight restriction digestion protocol was performed, and samples were sequenced at random by Sanger DNA sequencing to confirm the genotype.
6
Comprehensive Nucleic Acid Profiling Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Triethylammonium acetate (1 M), acetonitrile, adenosine, ammonium acetate, cytidine, deoxyadenosine, deoxycytidine, deoxyguanosine, formic acid, guanosine, sodium chloride, thymidine, and uridine were all obtained from Sigma-Aldrich (MO, USA). RNase I f , NEB Buffer 3, Cutsmart buffer, and alkaline phosphatase were obtained from New England Biolabs Inc. (MA, USA). RNase T1, ethanol, 10% sodium dodecyl sulfate, 1 M Tris-EDTA pH 7.0, 1 M Tris-EDTA pH 8.0, nuclease free water and ultrapure salmon sperm DNA were obtained from Thermo Fisher Scientic (NJ, USA). DNASep 4.6 Â 50 mm HPLC columns were purchased from ADS Biotec (NE, USA) and Cosmosil 5C18-MS-II 4.6 Â 150 mm columns were purchased from Nacalai (CA, USA). Oligonucleotides used in the study were from AgroRNA (Seoul, South Korea), Integrated DNA Technologies (IA, USA), and Trilink (San Diego, USA). Nucleic acids used in this study are shown in Table 1.
7
CRISPR gRNA Cloning Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequences of GGN18NGG or GGN17NGG in the sense or antisense strand of the DNA were selected as the target sites. Two DNA oligos (s1: 5’-ATAGGN18 [or N17] GT-3’; s2: 5’-TAAAC plus the reverse complement of GGN18 [or GGN17]-3’ ) were synthesized for each targeted site. The 2 DNA oligos (10 μM) were annealed in New England Biolabs (NEB) buffer 3 under previously described conditions [16 (link)]. A mixture of 4 μL of annealed solution, 5 μL of solution I (Takara) and 1 μL of purified gRNA cloning vector (Figure 1 A) digested with Bbs I (Thermo) was maintained at 16°C for 30 minutes and then transformed into competent bacteria for plasmid preparation and subsequent sequencing analysis to select the correct gRNA containing the target site sequence.
8
Tissue Barcoding: Microfluidic Channel Alignment
9
CRISPR-Cas12a-based ASFV detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All oligonucleotides, including the ASFV specific target sequence, primers, crRNAs (designed using benchling), reporters, and lateral flow capture probes were synthesized by Sangon Biotech (Shanghai, China) (Table 1 ). Biotin-labeled goat anti-mouse IgG (H+L) dispensed on the control line was from Beyotime Biotechnology (Shanghai, China). LbaCas12a, NEB buffer 3.1, Bst 2.0 WarmStart polymerase was purchased from New England Biolabs (Ipswich, MA, USA). Deoxynucleoside triphosphates (dNTPs) and Taq polymerase premix were purchased from Takara (Beijing, China).
Gold trichloride acid (HAuCl4.3H2O), trisodium citrate, and streptavidin (SA) were purchased from Sigma–Aldrich (Steinheim, Germany). Absorbent and fiberglass papers and nitrocellulose membranes were purchased from Sartorius AG (Gottingen, Germany). A dispenser to immobilize the biotin-labeled goat anti-mouse IgG and probe DNA on the LFB and a nitrocellulose membrane cutter were purchased from Shanghai Kinbio (Shanghai, China). A portable strip reader was from Goldbio Technology Co. (Shanghai, China). Genome and plasmid extraction kits were purchased from Qiagen (Hilden, Germany) and Tiangen Biotech (Beijing, China), respectively. All buffers used in this study were prepared in our laboratory. Other chemicals were purchased from standard commercial sources and were of pure analytical grade.
Gold trichloride acid (HAuCl4.3H2O), trisodium citrate, and streptavidin (SA) were purchased from Sigma–Aldrich (Steinheim, Germany). Absorbent and fiberglass papers and nitrocellulose membranes were purchased from Sartorius AG (Gottingen, Germany). A dispenser to immobilize the biotin-labeled goat anti-mouse IgG and probe DNA on the LFB and a nitrocellulose membrane cutter were purchased from Shanghai Kinbio (Shanghai, China). A portable strip reader was from Goldbio Technology Co. (Shanghai, China). Genome and plasmid extraction kits were purchased from Qiagen (Hilden, Germany) and Tiangen Biotech (Beijing, China), respectively. All buffers used in this study were prepared in our laboratory. Other chemicals were purchased from standard commercial sources and were of pure analytical grade.
10
Chip-based Protein-DNA Interaction Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this experiment, DNB-protein interactions were assessed on chip using BGISEQ500. For the experimental lane, the DNB-protein reaction mixture was composed of 0.1 μM dCas9 Streptococcus pyogenes [New England Biolabs, Inc. (NEB)], 3 μM corresponding gRNA, 1 μl of RNase inhibitor (Epicentre), 1X NEB buffer 3.1 (NEB), and nuclease-free water (Ambion) to a final volume of 300 μl. Before loading into the chip, the reaction mixture was incubated at room temperature for 15 min. Then, the reaction mixture was loaded into the BGISEQ500 V3.1 chip by the BGISEQ500 DNB loader and incubated for 4 hours at 37°C. For the control lane, 1X NEB buffer 3.1 (NEB) was used. A first imaging step was performed on the BGIseq500 sequencer (MGI) using imaging reagent (MGI). After the first imaging, the MDA reaction was performed using 100 nM phi29 DNA polymerase (NEB), 1× phi29 buffer (NEB), and 400 μM dNTP (NEB) with incubation at 30°C for 30 min. After the MDA reaction, a second imaging step was performed using the same protocol as the first imaging step.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!