Ultrasybr mixture high rox

Total RNA from the samples were isolated in the light of the protocol of Trizol reagent (Roche). One microgram (1 μg) total RNA was reversely transcribed into cDNA using SuperRT cDNA Synthesis Kit cDNA (CW Biotech, CW0741S, China). The level of Cox-2 gene was evaluated by performing real-time PCR utilizing UltraSYBR Mixture (High ROX) (CW Biotech, CW2602M, China). Primer sequences of Cox-2 are as follows: forward, AACGATCCCTCCCTTACCAT; reverse, GTTTAGACGTCCGGGAATTG. β-actin (forward, GATGAGATTGGCATGGCTTT; reverse, GTCACCTTCACCGTTCCAGT) served as the internal control. Relative expression of Cox-2 gene was calculated according to 2^−ΔΔCt method.

B. napus sample RNA was extracted by Trizol reagent (MagZol™ Reagent, Magen), and then DNA was cleaned by RNase-Free DNase I in RevertAid RT Kit (Thermo Scientific). RNA samples were reversed into cDNA by RiboLock RNase Inhibitor and RevertAid RT in RevertAid RT Kit. These cDNA worked as templates for quantitative real-time PCR (qPCR) to detect the expression of relative genes, the qPCR primers were designed by primer premier 5 (File S1). The qPCR reaction is performed with UltraSYBR Mixture (High ROX) (Cwbio), which contains GoldStar Taq DNA Polymerase, PCR Buffer, dNTPs, SYBR Green I fluorescent dyes, etc. Three-step quantitative real-time PCR program was performed as: 95 °C for 10 min, following 40 cycles of 95 °C for 10 s, 56–64 °C for 30 s and 72 °C for 32 s. Along with the melting curve procedure to detect the specificity of primer: 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s and 60 °C for 15 s. Expression data acquired were normalized with the actin gene of B. napus and calculated with the 2^−ΔΔCT method to analyze the relative changes in gene expression (Livak & Schmittgen, 2001 (link)).

To validate the expression changes observed from RNA-seq, we selected 10 genes that are putatively related to the JA pathway or defences and measured their expression using qPCR. For each sample, ~1μg total RNA was used to synthesise first-strand cDNA using the GoScript^™ Reverse Transcription Mix and Oligo(dT) kit (Promega, United States). The qPCRs reactions (in 10μl) were prepared according to the manufacturer’s instruction of UltraSYBR Mixture (High ROX; CWBIO, China). The qPCRs were performed on a StepOnePlus^™ Real-Time PCR System (Applied Biosystems, United States) with following PCR parameters: predenaturation at 95°C for 10min, 40cycles of denaturation at 95°C for 15s and annealing/elongation at 60°C for 1min and melting curve was carried out in the end of each PCR with the default program to validate the specificity of primers. Primer sequences of the 10 selected genes are shown in Supplementary Table 1. Tomato UBI3, a common internal reference gene for analysing gene expression changes affected by the JA-signalling pathway or biotic stresses (Fowler et al., 2009 (link)), was used as a reference gene. The expression at stage 4 from WT was used for calibration. Relative expression values were calculated using the 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)). Three biological replicates (samples from three plants) and two technical replicates were used.