Pcdna 3.1 vector pcdna

Human lung cancer cell lines (A549, Calu‐3, CAEP and SK‐MES‐1) and human bronchial epithelioid cells (HBE) were purchased from BeNa Culture Collection (Beijing, China) and cultured in Dulbecco's Modified Eagle Medium (DMEM) (Solarbio, Beijing, China) containing 10% fetal bovine serum (Zhejiang Tianhang Biotechnology, Huzhou, China) and 1% penicillin‐streptomycin solution (Procell, Wuhan, China).
The overexpression vectors of circCDR1as and SOX5 were generated with pcDNA3.1 vector (pcDNA) (YouBio, Changsha, China). The pcDNA vector was used as a negative control. The short interfering RNA (siRNA) for circCDR1as (si‐circCDR1as#1, 5′‐GCAAUAUCCAGGGUUUCCGAU‐3′; si‐circCDR1as#2, 5′‐UGUCUGCAAUAUCCAGGGUUU‐3′), siRNA negative control (si‐NC, 5′‐UUCUCCGAACGUGUCACGU‐3′), miR‐219a‐5p mimic (miR‐219a‐5p, 5′‐UGAUUGUCCAAACGCAAUUCU‐3′), mimic negative control (miR‐NC, 5′‐UUCUCCGAACGUGUCACGUTT‐3′), miR‐219a‐5p inhibitor (anti‐miR‐219a‐5p, 5′‐AGAAUUGCGUUUGGACAAUCA‐3′) and inhibitor negative control (anti‐NC, 5′‐CAGUACUUUUGUGUAGUACAA‐3′) were generated by Fulengen (Guangzhou, China). A549 and Calu‐3 cells were transfected with these conducted oligonucleotides or vectors using Lipofectamine 3000 (Thermo Fisher, Wilmington, DE, USA) for 24 hours.