Rever tra ace α transcriptase

Manufactured by Toyobo

Sourced in Japan

Rever-Tra-Ace-α-Transcriptase is a reverse transcriptase enzyme used in molecular biology laboratories. Its core function is to catalyze the conversion of RNA into complementary DNA (cDNA) molecules.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (3 mentions) Lightcycler 480 real time pcr system, by Roche (3 mentions) Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Sybr premix ex taqtm 2 tli rnaseh plus, by Takara Bio (1 mentions) Sybr premix ex taq 2 tli rnaseh plus kit, by Takara Bio (1 mentions) Sybr green master mix, by Thermo Fisher Scientific (1 mentions) Iscript cdna synthesis kit, by Bio-Rad (1 mentions) Rneasy kit, by Qiagen (1 mentions) One step plus system, by Thermo Fisher Scientific (1 mentions)

5 protocols using rever tra ace α transcriptase

Verifying Differential Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The differentially expressed genes screened via microarray were verified by qRT-PCR assay. Total RNA was extracted from tissue samples using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions and reverse-transcribed into cDNA with Rever-Tra-Ace-α- Transcriptase (Toyobo, Tokyo, Japan) and subsequently amplified by PCR using the SYBR^® Premix Ex Taq^TM II (Tli RNaseH Plus) (Takara, Tokyo, Japan). β-actin served as an internal control to normalize the RNA abundance. Quantitative PCR was performed on a LightCycler 480 Real-Time PCR system (Roche, Rotkreuz, Switzerland). The comparative Ct (
) method (8 (link)) was used to calculate the relative-fold changes of mRNA expression in treated cells against control cells, with P<0.05 representing a significant difference, and P<0.01 representing a highly significant difference. All reactions were performed in triplicate, and values are expressed as
±s.

Lian M., Wang H., Fang J., Zhai J., Wang R., Shen X., Yang Y., Ma Z, & Liu H. (2017). Microarray gene expression analysis of chemosensitivity for docetaxel, cisplatin and 5-fluorouracil (TPF) combined chemotherapeutic regimen in hypopharyngeal squamous cell carcinoma. Chinese Journal of Cancer Research, 29(3), 204-212.

+ Open protocol

+ Expand

Quantitative Analysis of PANDAR lncRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The cDNA was synthesized through reverse-transcription reaction with Rever-Tra-Ace-α-Transcriptase (Toyobo) and subsequently amplified by PCR using SYBR Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa Bio). The primer sequences used in quantitative real-time polymerase chain reaction (qRT-PCR) are listed as follows: GAPDH QRT F: CCCATGTTCGTCATGGGTGT; GAPDH QRT R: TGGTCATGAGTCCTTCCACGATA; PANDAR F: TCAGGAATGCCGCAGATGTA; PANDAR R: GACCGTGTCTGGAGGATGCC.

Sun Q, & Wang X. (2021). Regulatory roles of lncRNA PANDAR in breast cancer cell proliferation. Asian Biomedicine: Research, Reviews and News, 15(6), 285-291.

+ Open protocol

+ Expand

Quantitative PCR Analysis of TCN1 Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

As previously described,13 (link) total RNA was isolated from 23 patients’ frozen tumor specimens, and FaDu cells, using Trizol Reagent (Thermo Fisher Scientific) according to the manufacturer’s instruction. One microgram total RNA was reverse transcribed into cDNA using Rever-Tra-Ace-α-Transcriptase (Toyobo, Tokyo, Japan) and subsequently amplified by PCR using the SYBR^® Premix Ex Taq™ II (Tli RNaseH Plus; Takara, Tokyo, Japan). β-Actin served as an internal control to normalize the RNA abundance. Quantitative PCR (qPCR) was performed on a LightCycler 480 Real-Time PCR system (Hoffman-La Roche Ltd., Basel, Switzerland). The comparative Ct (2^−ΔΔCt) method was used to calculate the relative-fold changes of mRNA expression in different groups. The primer sequences are as follows: TCN1: 5′-CCCCTAGTGGGGCTCTTACT-3′ (forward) and 5′-CAGAGGTTTTAGGCGGATGTAG-3′ (reverse); β-actin: 5′-AGAGCTACGAGCTGCCTGAC-3′ (forward) and 5′-AGCACTGTGTTGGCGTACAG-3′ (reverse). All reactions were performed in triplicate, and values are expressed as means ± SD.

Wang Y., Yue C., Fang J., Gong L., Lian M., Wang R., Feng L., Ma H., Ma Z, & Liu H. (2018). Transcobalamin I: a novel prognostic biomarker of neoadjuvant chemotherapy in locally advanced hypopharyngeal squamous cell cancers. OncoTargets and therapy, 11, 4253-4261.

+ Open protocol

+ Expand

Quantification of miR-137 and XIAP mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of the cell lines was extracted using Trizol (Invitrogen) and was reverse transcribed with ReverTra-Ace-α-Transcriptase (TOYOBO, Osaka, Japan). The expression of miR-137 and XIAP mRNA in the cell lines was quantified using the SYBR Premix Ex Taq II (Tli RNase H Plus) kit (Takara, Tokyo, Japan), and U6 snRNA and GAPDH were used as internal references, respectively. Quantitative PCR was performed using the LightCycler 480 Real-Time PCR system (Roche). The data were analysed using LightCycler 480 Software Version 1.5.

Li X., Chen W., Zeng W., Wan C., Duan S, & Jiang S. (2016). microRNA-137 promotes apoptosis in ovarian cancer cells via the regulation of XIAP. British Journal of Cancer, 116(1), 66-76.

+ Open protocol

+ Expand

Quantifying TRF2 and miR-23a Levels

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time qPCR for TRF2 was carried out as described previously (Wang et al., 2013 (link)). Briefly, total RNAs were isolated using QIAGEN RNeasy Kit (Qiagen, Valencia, CA, USA) and reverse-transcribed using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). GAPDH was used as internal control for normalization. For miR-23a, total RNAs were isolated using Trizol (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed using ReverTra-Ace-α-Transcriptase (TOYOBO, Japan). U6 small nuclear RNAs were used as an internal control for normalization. All qPCRs were performed using SYBR green master mix (Applied Biosystems, USA) on Applied Biosystems One-step-plus system.
The primers for miR-23a and U6 were purchased from Ribobio, Guangzhou, China.
The TRF2 primers are TRF2-forward (5′- CCCAAGAACAAGCGCATGAC-3′) and TRF2-reverse (5′-GGGTTGGTTGAGAACGGTGG-3′). The GAPDH primers are GAPDH-forward (5′-GGAGCGAGATCCCTCCAAAAT-3′) and GAPDH-reverse (5′-GGCTGTTGTCATACTTCTCATGG-3′).
The TRF2 3′UTR qPCR primers for RNA pull-down are TRF2 3′UTR-forward (5′- CCAGGTTGATGACAGACCAG-3′) and TRF2 3′UTR-reverse (5′-AGATGTTGACAGCAAATGCC-3′).

Luo Z., Feng X., Wang H., Xu W., Zhao Y., Ma W., Jiang S., Liu D., Huang J, & Songyang Z. (2015). Mir-23a induces telomere dysfunction and cellular senescence by inhibiting TRF2 expression. Aging Cell, 14(3), 391-399.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!