Pcr cloning kit

Manufactured by Qiagen

Sourced in Germany, United States, United Kingdom

The PCR Cloning Kit is a laboratory equipment used for the amplification and cloning of DNA fragments. It provides the necessary reagents and protocols for performing polymerase chain reaction (PCR) and subsequent cloning of the amplified DNA into a suitable vector.

Automatically generated - may contain errors

Lab products found in correlation

Epitect bisulfite kit, by Qiagen (4 mentions) Pdrive, by Qiagen (4 mentions) Te300 inverted fluorescence microscope, by Nikon (3 mentions) T4 dna ligase, by New England Biolabs (3 mentions) Epi tech bisulfite, by Qiagen (3 mentions) Qiaprep spin miniprep kit, by Qiagen (3 mentions) Pcdh cmv mcs ef1 copgfp vector, by System Biosciences (3 mentions) Epimark 5 hmc and 5 mc analysis kit, by New England Biolabs (2 mentions) Purelink genomic dna isolation kit, by Thermo Fisher Scientific (2 mentions) Hot start ex taq polymerase, by Takara Bio (2 mentions) Hotstart it sybr green qpcr master mix, by Thermo Fisher Scientific (2 mentions) Lightcycler 480, by Roche (2 mentions) Topo xl cloning kit, by Thermo Fisher Scientific (2 mentions) Specific endonucleases hindii and kpni, by New England Biolabs (2 mentions) E coli dh5α, by Thermo Fisher Scientific (2 mentions) Ez competent cells, by Qiagen (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Pdrive vector, by Qiagen (1 mentions) Gel extraction kit, by Qiagen (1 mentions)

Spelling variants of this product

PCR Cloning Plus kit (11 citations)

35 protocols using pcr cloning kit

Bisulfite Sequencing of PTPRO CpG Island

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bisulfite-converted DNA was used to PCR amplify the PTPRO CpG island from -208 bp to +236 bp with respect to the transcription start site as described earlier; ref. [7 (link),8 (link),19 (link)]. The PCR product was purified using a gel extraction kit (Qiagen, Germany). The purified PCR product was used for bisulfite sequencing and was cloned into the pDrive vector according to the instructions of the PCR cloning kit (Qiagen, Germany). Ten randomly selected clones were subjected to automated sequencing. Direct sequencing was performed using the Thermo Sequenase Radiolabeled terminator cycle sequencing kit (Qiagen, Germany) with the primer hGlepp1-BS-F3 (5′-TAGGGGGATTGGAAAGGTAG-3′) following the manufacturer’s protocol.

Li S.Y., Li R., Chen Y.L., Xiong L.K., Wang H.L., Rong L, & Luo R.C. (2014). Aberrant PTPRO methylation in tumor tissues as a potential biomarker that predicts clinical outcomes in breast cancer patients. BMC Genetics, 15, 67.

+ Open protocol

+ Expand

Cloning and Visualizing Notch Pathway Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chicken Hes4 (Hairy1), Jag1, Jag2, Notch1 and Lfng were kind gifts of Nicolas Daudet (University College London, UK). Fragments of mouse Jag1, Jag2 and Notch1 and of human Jag1 and Notch1 were cloned by polymerase chain reaction (PCR; Table 1) from, respectively, E12.5 mouse cDNA (kind gift of Perrine Barraud, Dept. Physiology, Development and Neuroscience, University of Cambridge, UK) and cDNA prepared from 7‐week‐old dissected human foetal facial region (see previous section). Primer‐BLAST software from NCBI (Ye et al. 2012) was used to design appropriate PCR primers (Table 1) and check them for specificity. The oligonucleotide properties calculator program OligoCalc (Kibbe, 2007; http://www.basic.northwestern.edu/biotools/oligocalc.html) was used to check the melting temperature and self‐complementarity of the primers. cDNA fragments were amplified by PCR and the products cloned into pDrive (Qiagen) using the Qiagen PCR cloning kit. Sequencing was performed by the Biochemistry Department DNA Sequencing Facility, University of Cambridge (Cambridge, UK). Digoxigenin‐labelled antisense riboprobes were generated using standard methods (Henrique et al. 1995) and in situ hybridisation performed on cryosections as previously described (O'Neill et al. 2007), except that the slides were not treated with proteinase K.

Miller S.R., Perera S.N., Benito C., Stott S.R, & Baker C.V. (2016). Evidence for a Notch1‐mediated transition during olfactory ensheathing cell development. Journal of Anatomy, 229(3), 369-383.

+ Open protocol

+ Expand

Genome-wide DNA Methylation Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated using Purelink genomic DNA isolation kits (Invitrogen). For locus-wide bisulfite sequencing, CATCH-seq was performed as described^{12 (link)}, using BAC clone RP24-330J12 (BACPAC Resource Center, CHORI). For amplicon sequencing, bisulfite conversion was performed using the EpiTect Bisulfite Kit (Qiagen). Amplicons were prepared using Hot Start Ex-Taq Polymerase (TaKaRa) and the following primers: TSS-F: 5′-GGGGTATTTATTGTTTTGAGTAT-3′, TSS-R: 5′-TTTAATTTTTCAACTTCCCCAAC-3′, +1600-F: 5′-GGTTATTTGGAGTTTTTTTTTAG-3′, +1600-R: 5′-CTTCAATTCATAAACTTATTCCC-3′, and TA cloned using the Qiagen PCR cloning kit. Bisulfite analysis of Sanger sequenced clones was performed using QUMA^{40 (link)}. Oxidative bisulfite treatment was performed as previously described^{41 (link)} and amplicons were analyzed as above using the following primers: +1400-F: 5′-AAGTGTTTAAAATGTGTTAATTATTG-3′, +1400-R: 5′-TTAAAAACAAAACTAAAAAAACCC-3′. T4-βGT-mediated 5mC- and 5hmC- sensitive restriction enzyme digest was performed using the EpiMARK 5-hmC and 5mC analysis kit according to the manufacturer’s instructions (New England Biolabs). Quantitative PCR was performed using HotStart-IT SYBR Green qPCR Master Mix (Affymetrix-USB) and a LightCycler 480 (Roche). Percent digestion was calculated using ΔΔCt.

Sellars M., Huh J.R., Day K., Issuree P.D., Galan C., Gobeil S., Absher D., Green M.R, & Littman D.R. (2015). Regulation of DNA methylation dictates Cd4 gene expression during development of helper and cytotoxic T cell lineages. Nature immunology, 16(7), 746-754.

+ Open protocol

+ Expand

Amplified Bisulfite PCR Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

Amplified bisulfite PCR products for each samples described above were subcloned using the PCR Cloning Kit (Qiagen). Plasmid DNA of 10 insert-positive clones for each PCR product were sequenced in both directions with M13 primers.

Strygina K.V, & Khlestkina E.K. (2019). Myc-like transcriptional factors in wheat: structural and functional organization of the subfamily I members. BMC Plant Biology, 19(Suppl 1), 50.

+ Open protocol

+ Expand

Bisulfite-Converted DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bisulfite-converted DNA was used for PCR with Hot-StarTaq (Qiagen). Primers sequences are listed in Supplementary Table 2. PCR products were cloned using the PCR Cloning kit (Qiagen). Quantification Tool for Methylation Analysis (QUMA) was used for methylation analysis.

Lee Y., Lee M., Lee S.W., Choi N.Y., Ham S., Lee H.J., Ko K, & Ko K. (2019). Reprogramming of spermatogonial stem cells into pluripotent stem cells in the spheroidal state. Animal Cells and Systems, 23(6), 392-398.

+ Open protocol

+ Expand

Cloning and Screening of PCR Amplicons

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR amplicons were cloned with the Qiagen PCR cloning Kit® (Qiagen, Hilden, Germany). Cloning followed the protocol described in Bracamonte et al. [59 (link)]. For clone screening, 1 μl of the denatured clones was used as template for a PCR with the universal M13 primers: M13_Funi (5′ACGACGTTGTAAAACGACGGCCAG 3′), and M13_RP15 (5′TTCACACAGGAAACAGCTATGACC 3′). The reaction had a final volume of 10 μl, included 1 μl 10x Dreamtaq Buffer, 0.5 μl dNTPs (10 mM), 1 μl of each primer (5 pmol / μl), 0.1 μl Taq Polymerase (Dreamtaq®), and ran using the following thermal profile: initial denaturing step at 95 °C for 1 min, followed by 25 cycles of denaturing at 96 °C for 10 s, annealing at 50 °C for 10 s, elongation at 72 °C for 1 min, with a final elongation at 72 °C for 7 min. Two μl of this PCR product were then loaded in a 1% agarose gel and run for 30 min at 90 V, and ultimately stained with Ethidium bromide to visualize bands. We sequenced the clones that were positive for the amplicon. We sequenced between 16 and 48 clones per amplification in order to detect rare alleles.

Hofmann M.J., Bracamonte S.E., Eizaguirre C, & Barluenga M. (2017). Molecular characterization of MHC class IIB genes of sympatric Neotropical cichlids. BMC Genetics, 18, 15.

+ Open protocol

+ Expand

Molecular Cloning and In Situ Hybridization

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chicken Hes4 (Hairy1), Jag1, Jag2, Notch1 and Lfng were kind gifts of Nicolas Daudet (University College London, UK). Fragments of mouse Jag1, Jag2 and Notch1 and of human Jag1 and Notch1 were cloned by PCR (Table 1) from, respectively, embryonic day (E)12.5 mouse cDNA (kind gift of Perrine Barraud, Dept. Physiology, Development and Neuroscience, University of Cambridge, UK) and cDNA prepared from 7-week-old dissected human foetal facial region (see previous section). Primer-BLAST software from NCBI (Ye et al., 2012 (link)) was used to design appropriate PCR primers (Table 1) and check them for specificity. The oligonucleotide properties calculator program OligoCalc (Kibbe, 2007 (link)) (http://www.basic.northwestern.edu/biotools/oligocalc.html) was used to check the melting temperature and self-complementarity of the primers. cDNA fragments were amplified by PCR and the products cloned into pDrive (Qiagen) using the Qiagen PCR cloning kit. Sequencing was performed by the Biochemistry Department DNA Sequencing Facility, University of Cambridge (Cambridge, UK). Digoxigenin-labelled antisense riboprobes were generated using standard methods (Henrique et al., 1995 (link)) and in situ hybridisation performed on cryosections as previously described (O'Neill et al., 2007 (link)) except that the slides were not treated with proteinase K.

Miller S.R., Perera S.N., Benito C., Stott S.R, & Baker C.V. (2016). Evidence for a Notch1‐mediated transition during olfactory ensheathing cell development. Journal of Anatomy, 229(3), 369-383.

+ Open protocol

+ Expand

Cloning and Characterization of Putative Biotin Biosynthesis Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

From the genome sequence of N. gargensis (NCBI GenBank accession no. CP002408), the putative bioF, bioA, bioD and bioB genes were chosen for cloning (Table S1). Six different ORFs that were annotated as putative α/β-hydrolase fold proteins and could therefore serve as counterpart of the bacterial BioH were also selected as well as four possible candidates that could serve as bioC analogues (bioC1-4). The ORFs Ngar_c21820, Ngar_c24650, Ngar_c14400 (i. e. estN1), Ngar_c30910 (i. e. estN2), Ngar_c32780 and Ngar_c35080, which could possibly encode a BioH analogue, were amplified with specific primers, cloned into pDrive (PCR Cloning Kit, Qiagen, Hilden, Germany) and transformed into competent E. coli DH5α cells. As they encode carboxylesterases, the different clones were first tested on TBT agar plates at 37 °C for general activity. The plates were incubated for up to 6 days at 37 °C in order to see halos around active E. coli colonies expressing active carboxylesterases from N. gargensis. The genes estN1 and estN2 from the active clones and the bioFADBC genes were further separately cloned into the multiple-cloning site of pET21a(+) expression vectors (Novagen/Merck, Darmstadt, Germany) encoding a C-terminal six-fold histidine tag (His₆-tag).

Chow J., Danso D., Ferrer M, & Streit W.R. (2018). The Thaumarchaeon N. gargensis carries functional bioABD genes and has a promiscuous E. coli ΔbioH-complementing esterase EstN1. Scientific Reports, 8, 13823.

+ Open protocol

+ Expand

RNA Extraction and Cloning of Axenic MV and PC Genes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation from in vitro cultivated axenic MV and PC was performed using a Trizol (5Prime, Hamburg, Germany)-based method as previously described [45 (link)]. For reverse transcription, 2 μg total RNA was used for cDNA synthesis using oligonucleotide CD3-RT (5’-ATC TCT TGA AAG GAT CCT GCA GGT₂₆ V^-3’). PCR products were cloned using the PCR cloning Kit (QIAGEN, Hilden, Germany) or the TOPO XL cloning Kit (Invitrogen). The complete list of primer sequences used for empim and emcdc25 cDNA amplification and characterization is given in S2 Table. Upon cloning, PCR products were directly sequenced using primers binding to vector sequences adjacent to the multiple cloning site by Sanger Sequencing (Microsynth Seqlab, Göttingen, Germany). The sequences of all genes newly characterized in this work have been submitted to the GenBank database and are available under the accession numbers ON005010 (empim) and ON005011 (emcdc25). Accession numbers of all other proteins or genes analysed in this work are listed in S3 Table.

Koike A., Becker F., Sennhenn P., Kim J., Zhang J., Hannus S, & Brehm K. (2022). Targeting Echinococcus multilocularis PIM kinase for improving anti-parasitic chemotherapy. PLoS Neglected Tropical Diseases, 16(10), e0010483.

+ Open protocol

+ Expand

P5P6 Protein Transcript Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

The P5P6 protein transcript was created by recreating the P5P6 splicing event in the full length RON cDNA which had previously been attached to GFP. The region between exons 3 and 8 was amplified using the primers (F – GGGACCAGGTTTTCCAGGTACC and R – GGTACCTGGTTCCTGGACCTTCCAG) from a primary pancreatic cancer sample. The PCR amplicon was TA cloned using a PCR Cloning Kit (Qiagen) and competent DH5α E. Coli (Invitrogen). The full length RON+eGFP vector and the P5P6 containing vector were cut with specific endonucleases HindII and KpnI (NEB) and ligated using T4 DNA Ligase (NEB). DNA sequencing confirmed correct P5P6 sequence and the cDNA was then transferred into a lentiviral plasmid for transfection. After transfection selective puromycin media was used and the TE300 inverted fluorescence microscope (Nikon) was used to screen for green fluorescence.

Chakedis J., French R., Babicky M., Jaquish D., Howard H., Mose E., Lam R., Holman P., Miyamoto J., Walterscheid Z, & Lowy A.M. (2015). A novel protein isoform of the RON tyrosine kinase receptor transforms human pancreatic duct epithelial cells. Oncogene, 35(25), 3249-3259.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!