Log In Sign up
The largest database of trusted experimental protocols

Quantitech rt kit

Manufactured by Qiagen
Visit Supplier
Sourced in United Kingdom

The QuantiTech RT Kit is a laboratory equipment product designed for reverse transcription. It is used to convert RNA into cDNA, which can then be utilized for various downstream applications such as qPCR analysis.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green master mix, by Thermo Fisher Scientific (5 mentions) Direct zol rna miniprep kit, by Zymo Research (3 mentions) Deoxyribonuclease, by Qiagen (2 mentions) Rneasy kit, by Qiagen (1 mentions) Rnaeasy mini kit, by Qiagen (1 mentions) Direct zol rna miniprep, by Zymo Research (1 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Dnase, by Qiagen (1 mentions) Rnaeasy lipid mini kit, by Qiagen (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) On column dna digest, by Qiagen (1 mentions) Rneasy rna isolation kit, by Qiagen (1 mentions) Sybr advantage qpcr premix, by Takara Bio (1 mentions)

Spelling variants of this product

QuantiTech SYBR Green RT-PCR kit (7 citations) QuantiTech RT (2 citations)

9 protocols using quantitech rt kit

1

MGDI Cloning from Mouse Brain

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from brains of intracranial HIFko tumor-bearing mice using the Rneasy kit (QIAGEN). RNA from two brains (1 µg) was used for cDNA synthesis by the QuantiTech RT Kit (QIAGEN). Full-length MGDI was cloned to the pcDNA3-9E10 plasmid using the following primers: forward: GGAATTCGCGGACGCCTTTGTCGGTACCTGGAAG; reverse: CCTCGAGTCACGCCTCCTTCTCATAAGTCCGAGTGCTC.
Hyvönen M., Enbäck J., Huhtala T., Lammi J., Sihto H., Weisell J., Joensuu H., Rosenthal-Aizman K., El-Andaloussi S., Langel U., Närvänen A., Bergers G, & Laakkonen P. (2014). Novel target for peptide-based imaging and treatment of brain tumors. Molecular cancer therapeutics, 13(4), 996-1007.
+ Open protocol
+ Expand
2

RNA Isolation and Quantitative PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from tissue flash-frozen in liquid nitrogen using an RNAeasy mini kit (QIAGEN) according to the manufacturer’s instructions. A deoxyribonuclease (QIAGEN) step to digest the genomic DNA was included. cDNA was made from isolated RNA using oligo(dt) and random hexamer primers and reverse transcriptase (QuantiTech RT kit; QIAGEN). Quantitative PCR was performed using the 7800HT (Applied Biosystems) thermal cycler and SYBR Green master mix (Applied Biosystems). Relative mRNA abundance was calculated and normalized to levels of TATA box-binding protein. Primers are available in Suppl. Table 2.
Sandhu B., Matos M.C., Tran S., Singhal G., Syed I., Feldbrügge L., Mitsuhashi S., Pelletier J., Huang J., Yalcin Y., Csizmadia E., Tiwari-Heckler S., Enjyoji K., Sévigny J., Maratos-Flier E., Robson S.C, & Jiang Z.G. (2021). Global deletion of NTPDase3 protects against diet-induced obesity by increasing basal energy metabolism. Metabolism: clinical and experimental, 118, 154731.
+ Open protocol
+ Expand
3

Hypothalamic Gene Expression in Obesity

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice were assigned to the following experimental groups, with n = 6 in each group: lean PBS-treated mice, lean TDCA/valine-treated mice, DIO-obese PBS-treated mice, DIO-obese PBS-treated mice fasted for 12 hr before tissue procurement, DIO-obese TDCA/valine-treated mice, DIO-obese TDCA/valine-treated mice fasted for 12 hr before tissue procurement, DIO-obese mice undergoing sleeve gastrectomy. Cage beddings were pooled and redistributed at days −6, –4, and −2 to normalize microbial flora among experimental groups. At day 0, treatment began and SGx were performed. Mice were treated for 13 days, with procurement of tissues performed on day 14. Animals were anesthetized with ketamine and sacrificed by decapitation. Brains were removed, and hypothalamus tissue was dissected and flash-frozen in liquid nitrogen. RNA was isolated using Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA). cDNA was made from isolated RNA using oligo (dt), random hexamer primers, and reverse transcriptase QuantiTech RT Kit (Qiagen, Germantown, MD). Quantitative PCR was performed using the 7800HT (Applied Biosystems, Foster City, CA) thermal cycler and SYBR Green master mix (Applied Biosystems). Relative mRNA abundance was calculated and normalized to levels of the housekeeping gene cyclophilin A.
Quante M., Iske J., Heinbokel T., Desai B.N., Cetina Biefer H.R., Nian Y., Krenzien F., Matsunaga T., Uehara H., Maenosono R., Azuma H., Pratschke J., Falk C.S., Lo T., Sheu E., Tavakkoli A., Abdi R., Perkins D., Alegre M.L., Banks A.S., Zhou H., Elkhal A, & Tullius S.G. (2021). Restored TDCA and valine levels imitate the effects of bariatric surgery. eLife, 10, e62928.
+ Open protocol
+ Expand
4

RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from flash-frozen tissue using a Direct-zol™ RNA MiniPrep (Zymo Research) according to manufacturer’s instructions. A deoxyribonuclease (QIAGEN) step to digest the genomic DNA was included. cDNA was made from 500 ng isolated RNA using oligo(dt) and random hexamer primers and reverse transcriptase (QuantiTech RT kit; QIAGEN). Quantitative PCR was performed using the 7900HT (Applied Biosystems) thermal cycler and SYBR Green PCR master mix (Applied Bio-systems). Relative expression of mRNAs was calculated and normalized to levels of 36B4 for all tissues using the 2−ΔΔCt method. Primer sequences are available upon request.
Watanabe M., Singhal G., Fisher F.M., Beck T.C., Morgan D.A., Socciarelli F., Mather M.L., Risi R., Bourke J., Rahmouni K., McGuinness O.P., Flier J.S, & Maratos-Flier E. (2019). Liver derived FGF21 is essential for full adaptation to ketogenic diet but does not regulate glucose homeostasis. Endocrine, 67(1), 95-108.
+ Open protocol
+ Expand
5

RNA Isolation and Quantitative PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ribonucleic acid (RNA) was isolated from tissue flash-frozen in liquid nitrogen using an RNAeasy Lipid mini kit (Qiagen, Germantown, MD) according to manufacturer’s instructions. A DNase (Qiagen, Germantown, MD) step to digest the genomic DNA was included. Complementary DNA (cDNA) was made from isolated RNA using oligo(dt) and random hexamer primers and reverse transcriptase (QuantiTech RT Kit; Qiagen, Germantown, MD). Quantitative PCR was performed using the 7800HT (Applied Biosystems, Foster City, CA) thermal cycler and SYBR Green master mix (Applied Biosystems, Foster City, CA). Relative mRNA abundance was calculated and normalized to levels of the housekeeping gene 36B4. Primers are included in Supplementary Table 1.
Douris N., Melman T., Pecherer J.M., Pissios P., Flier J.S., Cantley L.C., Locasale J.W, & Maratos-Flier E. (2015). Adaptive changes in amino acid metabolism permit normal longevity in mice consuming a low-carbohydrate ketogenic diet. Biochimica et biophysica acta, 1852(10 Pt A), 2056-2065.
+ Open protocol
+ Expand
6

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the RNeasy Mini kit including an on-column DNA digest (Qiagen, Manchester, UK). From 500 to 800 ng total RNA was converted into cDNA using the QuantiTech-RT kit (Qiagen, Manchester, UK). A total of 10 μg of cDNA was used to detect sequence-specific amplicons using the primer sets summarised in Table 1. qPCR reactions were carried out with the SyGreen Blue Hi-ROX master mix (PCRBiosystems, Highgate, UK) and run in a StepOnePlusTM Real-time PCR system. Cycling conditions were: 95 °C for 2 min, and 40 cycles of denaturation at 95 °C for 5 s and annealing at 60 °C for 30 s. Gene expression relative to 18S RNA was determined using the Pfaffl method that incorporates the amplicon specific PCR efficiencies (E) estimated by cDNA dilution series [63 (link)] (1): Fold-change=Etarget∆Ct target Control−SampleEreference 18S∆Ct reference Control−Sample
Yousaf I., Kaeppler J., Frost S., Seymour L.W, & Jacobus E.J. (2020). Attenuation of the Hypoxia Inducible Factor Pathway after Oncolytic Adenovirus Infection Coincides with Decreased Vessel Perfusion. Cancers, 12(4), 851.
+ Open protocol
+ Expand
7

Quantifying hERG mRNA Expression in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cellular mRNA was extracted and purified from HeLa cells using RNeasy RNA isolation kits (Qiagen). Equal quantities of mRNA were reverse-transcribed into cDNA using QuantiTech RT kit (Qiagen) and amplified using SYBR advantage qPCR premix (Clonetech). hERG mRNA content normalized for that of GAPDH. Non-template control and untransfected (parental) cells used for GAPDH and hERG background, respectively. hERG and GAPDH-specific primers were designed using the NCBI primer design tool and listed below.
hERG forward: GGCCAGAGCCGTAAGTTCAT
hERG reverse: TGCAGGAAGTCGCAGGTG
GAPDH forward: CATGAGAAGTATGACAACAGCCT
GAPDH reverse: AGTCCTTCCACGATACCAAAGT
Foo B., Barbier C., Guo K., Vasantharuban J., Lukacs G.L, & Shrier A. (2019). Mutation-specific peripheral and ER quality control of hERG channel cell-surface expression. Scientific Reports, 9, 6066.
+ Open protocol
+ Expand
8

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from tissue flash-frozen in liquid nitrogen using Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA). cDNA was made from isolated RNA using oligo(dt) and random hexamer primers and reverse transcriptase (QuantiTech RT Kit; Qiagen, Germantown, MD). Quantitative PCR was performed using the 7800HT (Applied Biosystems, Foster City, CA) thermal cycler and SYBR Green master mix (Applied Biosystems, Foster City, CA). Relative mRNA abundance was calculated and normalized to levels of the housekeeping gene 36B4. Primers are included in Supplementary Table 1.
Douris N., Desai B.N., Fisher F.M., Cisu T., Fowler A.J., Zarebidaki E., Nguyen N.L., Morgan D.A., Bartness T.J., Rahmouni K., Flier J.S, & Maratos-Flier E. (2017). Beta-adrenergic receptors are critical for weight loss but not for other metabolic adaptations to the consumption of a ketogenic diet in male mice. Molecular Metabolism, 6(8), 854-862.
+ Open protocol
+ Expand
9

Liver RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from livers flash-frozen in liquid nitrogen using Direct-zol RNA MiniPrep kit (Zymo Research, Irvine CA). cDNA was made from isolated RNA using oligo (dt), random hexamer primers and reverse transcriptase QuantiTech RT Kit (Qiagen, Germantown MD). Quantitative PCR was performed using the 7800HT (Applied Biosystems, Foster City CA) thermal cycler and SYBR Green master mix (Applied Biosystems, Foster City CA). Relative mRNA abundance was calculated and normalized to levels of the housekeeping gene 36B4.
Desai B.N., Singhal G., Watanabe M., Stevanovic D., Lundasen T., Fisher F.M., Mather M.L., Vardeh H.G., Douris N., Adams A.C., Nasser I.A., FitzGerald G.A., Flier J.S., Skarke C, & Maratos-Flier E. (2017). Fibroblast growth factor 21 (FGF21) is robustly induced by ethanol and has a protective role in ethanol associated liver injury. Molecular Metabolism, 6(11), 1395-1406.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!