Evagreen 2x qpcr mastermix low rox

Manufactured by Applied Biological Materials

EvaGreen 2X qPCR MasterMix-Low ROX is a ready-to-use reaction mixture for quantitative real-time PCR (qPCR) applications. It contains EvaGreen dye, a fluorescent DNA-binding dye, and a low concentration of ROX passive reference dye. The master mix is optimized for sensitive and reliable qPCR performance.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop one, by Thermo Fisher Scientific (3 mentions) 7500 real time pcr, by Thermo Fisher Scientific (2 mentions) All in one rt mastermix, by Applied Biological Materials (2 mentions) Veriti 96 well thermal cycler, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Mirna cdna synthesis kit, by Applied Biological Materials (1 mentions) Easyscript one step gdna removal and cdna synthesis supermix, by Transgene (1 mentions) Trizol, by Tiangen Biotech (1 mentions)

Spelling variants of this product

EvaGreen qPCR Mastermix (78 citations) EvaGreen 2X qPCR MasterMix (32 citations) QPCR MasterMix (10 citations) EvaGreen (5 citations) EvaGreen 2X qPCR MasterMix-ROX (3 citations) EvaGreen MasterMix-Low ROX (3 citations) EvaGreen qPCR MasterMix-Low Rox (2 citations)

3 protocols using evagreen 2x qpcr mastermix low rox

Quantitative RT-PCR Analysis of Immune Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from spleens or aortas by the TRIzol Reagent (Ambion). 100 ng of spleen RNA and 40 ng aorta RNA were quantified with NanoDrop One (Thermo Scientific) and reverse transcribed using 5X All-In-One RT MasterMix (abm) preformed in Veriti 96-Well Thermal Cycler (Applied Biosystems). Quantitative real-time PCR was performed in 7500 Real-Time PCR (Applied Biosystems) using specific primers (synthesized by Sangon Biotech) and EvaGreen 2X qPCR MasterMix-Low ROX (abm). Reverse transcription and amplification conditions followed the reagent instructions. Data were analyzed via the 2^-ΔΔCt method normalized to Gapdh. Sequences of primers were used as follows from 5′ to 3′ extremity:

Gapdh: AGGTCGGTGTGAACGGATTTG (F); TGTAGACCATGTAGTTGAGGTCA (R)

Stat3: CAATACCATTGACCTGCCGAT (F); GAGCGACTCAAACTGCCCT (R)

Stat5a: CGCCAGATGCAAGTGTTGTAT (F); TCCTGGGGATTATCCAAGTCAAT (R)

Jak2: TTGTGGTATTACGCCTGTGTATC (F); ATGCCTGGTTGACTCGTCTAT (R)

Socs3: ATGGTCACCCACAGCAAGTTT (F); TCCAGTAGAATCCGCTCTCCT (R)

Foxp3: CACCTATGCCACCCTTATCCG (F); CATGCGAGTAAACCAATGGTAGA (R)

Tgfb1: TGACGTCACTGGAGTTGTACGG (F); GGTTCATGTCATGGATGGTGC (R)

Cd80: ACCCCCAACATAACTGAGTCT (F); TTCCAACCAAGAGAAGCGAGG (R)

Cd86: AGTGATCGCCAACTTCAGTGAACC (F); GGTGACCTTGCTTAGACGTGCAG (R).

Qiu R., Long J., Zhou L., Ma Y., Zhao L., Liu F, & Yuan D. (2019). Yangyin Qingre Huoxue Method in Traditional Chinese Medicine Ameliorates Atherosclerosis in ApoE−/− Mice Suffering from High-Fat Diet and HSP65 Aggression. Evidence-based Complementary and Alternative Medicine : eCAM, 2019, 2531979.

+ Open protocol

+ Expand

Comprehensive RNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissue and cells using TRIzol (TianGen). 3 μg total RNA was subjected to reverse transcription reaction using EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen). qRT-PCR analyses were performed using EvaGreen 2X qPCR MasterMix-Low ROX (ABM). For miRNA detection, cDNA was synthesized using miRNA cDNA Synthesis Kit (ABM) and then amplified using miRNA qPCR profiling kits (ABM). GAPDH is used as an internal reference for lncRNA and mRNA, and U6 is used as an internal reference for miRNA. The primer sequences used for qRT-PCR are shown in Table S3.

Zhang X., Pan B., Qiu J., Ke X., Shen S., Wang X, & Tang N. (2022). lncRNA MIAT targets miR-411-5p/STAT3/PD-L1 axis mediating hepatocellular carcinoma immune response. International journal of experimental pathology, 103(3).

+ Open protocol

+ Expand

Quantification of Dnmt Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol Reagent (Invitrogen) was used to extract total RNA from spleens or aortas. 100 ng/10µL of spleen or aorta RNA were quanti ed with NanoDrop One (Thermo Scienti c) and 5X All-In-One RT MasterMix (abm) was used for reverse transcription in Veriti 96-Well Thermal Cycler (Applied Biosystems). 7500 Real-Time PCR (Applied Biosystems) was used for qRT-PCR using speci c primers (synthesized by Sangon Biotech) and Eva Green 2X qPCR Master Mix-Low ROX (abm). Reverse transcription and ampli cation conditions followed the reagent instructions. Data were analyzed via the 2 -ΔΔCt method normalized to β-Actin. Sequences of primers were used as follows from 5' to 3' extremity:
i. β-Actin: GGCTGTATTCCCCTCCATCG (F); CCAGTTGGTAACAATGCCATGT (R);
ii. Dnmt1: ATCCTGTGAAAGAGAACCCTGT (F); CCGATGCGATAGGGCTCTG (R);
iii. Dnmt3b: AGCGGGTATGAGGAGTGCAT (F); GGGAGCATCCTTCGTGTCTG (R)

Zhou L., Long J., Sun Y., Chen W., Qiu R., & Yuan D. (2020). Resveratrol Ameliorates Atherosclerosis Induced by High-fat Diet and LPS in ApoE-/- Mice and Inhibits the Activation of CD4+ T Cells by Regulating the Expression of Dnmt.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!