Total RNAs from liver tissues were extracted by TRIZOL reagent (Thermo Fisher) and then reverse transcribed using PrimeScript RT Reagent Kit (Takara, Beijing, China). Real-time polymerase chain reaction (PCR) cycles were programmed on a QuantStudio 3 Real-Time system (Thermo Fisher) and SYBR green PCR Master Mix (Thermo Fisher) was used. Primers used in reverse-transcription PCR included: caspase-11 forward: 5′-ACAAACACCCTGACA AACCAC-3′, reverse: 5′-CACTGCGTTCAGCATTGTTAAA-3′; TGF-β forward: 5′-CTCCC GTGGCTTCTAGTGC-3′, reverse: 5′-GCCTTAGTTTGGACAGGATCTG-3′; α-SMA forward: 5′- GTCCCAGACATCAGGGAGTAA-3′, reverse: 5′-TCGGATACTTCAGCGTCAGGA-3′; Col1a1: forward: 5′- GCTCCTCTTAGGGGCCACT -3′, reverse: 5′- CCACGTCTCACCATT GGGG -3′; F4/80 forward: 5′-TGACTCACCTTGTGGTCCTAA-3′, reverse: 5′- CTTCCCAG AATCCAGTCTTTCC -3′; GAPDH forward: 5′-AGGTCGGTGTGAACGGATTTG -3′, reverse: 5′- TGTAGACCATGTAGTTGAGGTCA -3′.
Quantstudio 3 real time system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The QuantStudio 3 Real-Time PCR System is a compact and flexible instrument designed for real-time quantitative PCR (qPCR) analysis. It features a 96-well block format and supports multiple real-time PCR assay chemistries. The system provides accurate and reliable data for a wide range of applications, including gene expression analysis, genotyping, and pathogen detection.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Allprep dna rna protein midi kit, by Qiagen (2 mentions)
Rt2 qpcr primer system, by Qiagen (2 mentions)
Sybr green master mix, by Thermo Fisher Scientific (2 mentions)
High capacity reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Taqman mirna assay, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Quantitect sybr green pcr kit, by Qiagen (1 mentions)
Sybr green supermix, by Bio-Rad (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Ma1 744, by Thermo Fisher Scientific (1 mentions)
Iscript reverse transcription supermix, by Bio-Rad (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Dnmt3b, by Abcam (1 mentions)
H3k27me3, by Cell Signaling Technology (1 mentions)
Dnmt1, by Santa Cruz Biotechnology (1 mentions)
Powertrack sybr green master mix, by Thermo Fisher Scientific (1 mentions)
11 protocols using quantstudio 3 real time system
1
Liver RNA Extraction and Gene Expression Analysis
2
Quantitative Real-Time PCR Analysis of ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from frozen esophageal samples (ESCC tissue and adjacent normal epithelium) using an RNeasy Mini Kit (Qiagen, Germantown, MD, USA) and from cultured cells using Trizol reagent (Ambion, Austin, TX, USA). First-strand cDNA synthesis and PCR analysis were carried out as previously described by Shin et al. (16 (link)). The genes of interest and the sequences of the specific primer pairs used in real-time PCR quantification are listed in Table 1 Table 1 ) for 30 s, and extension at 72°C for 20 s using the QuantiTect SYBR Green PCR Kit (Qiagen) and the QuantStudio3 Real-Time system (Thermo Fisher Scientific).
3
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction and RT-PCR experiments were conducted as previously described [50 (link)]. cDNA was synthesized using Superscript III (18080-044, Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. A quantity of 1 µg of total RNAs were used to perform the reverse transcription experiments. Primers used were:
Dr_eed_cDNA_5′: GGAAACGAGATGCCGAACAA
Dr-eed_cDNA_3′a: CAGCCGGATCTCTCCCTGAG
Dr_cDNA_ube2a_F: TGACTGTTGACCCACCTTACAG
Dr_cDNA_ube2a_R: CAAATAAAAGCAAGTAACCCCG
Dr_beta-actin_cDNA_5′: CGTGACATCAAGGAGAAGCT
Dr_beta-actin_cDNA_3′: ATCCACATCTGCTGGAAGGT
qPCR_fasn_5′: CCAGCCATAAGAACGTCAGCCGAGA
qPCR_fasn_3′: CACCTTCCCGTCACACACCTCGT
qPCR_srebf1_5′: ACAGCGCGGCTAATGGCAGG
qPCR_srebf1_3′: TGCCCAGGAGCCGACAGGAA
qPCR_pparg_5′: GCACAGGCGCTTCAGTGTTCAG
qPCR_pparg_3′: CCAGCGAGTGCGTGTCGTCC
qPCR_nr1h3_5′: ACCCAGCGATTGACAGCATCACCT
qPCR_nr1h3_3′: CCTGCACGTTTGGTCGGTCTGCT
PCR reactions were performed as follow: 95 °C 4 min, (95 °C 45 s, 65 °C 45 s, 72 °C 1 min) 35 cycles, 72 °C 10 min.
The quantitative qPCR reaction was performed in triplicate using a QuantStudio 3 Real-Time System (Thermo Fisher Scientific, Waltham, MA, USA) using SYBR Green Supermix (Bio-Rad, Marne-la-Coquette, France). Relative mRNA expression of each gene was normalized to ube2a levels.
Dr_eed_cDNA_5′: GGAAACGAGATGCCGAACAA
Dr-eed_cDNA_3′a: CAGCCGGATCTCTCCCTGAG
Dr_cDNA_ube2a_F: TGACTGTTGACCCACCTTACAG
Dr_cDNA_ube2a_R: CAAATAAAAGCAAGTAACCCCG
Dr_beta-actin_cDNA_5′: CGTGACATCAAGGAGAAGCT
Dr_beta-actin_cDNA_3′: ATCCACATCTGCTGGAAGGT
qPCR_fasn_5′: CCAGCCATAAGAACGTCAGCCGAGA
qPCR_fasn_3′: CACCTTCCCGTCACACACCTCGT
qPCR_srebf1_5′: ACAGCGCGGCTAATGGCAGG
qPCR_srebf1_3′: TGCCCAGGAGCCGACAGGAA
qPCR_pparg_5′: GCACAGGCGCTTCAGTGTTCAG
qPCR_pparg_3′: CCAGCGAGTGCGTGTCGTCC
qPCR_nr1h3_5′: ACCCAGCGATTGACAGCATCACCT
qPCR_nr1h3_3′: CCTGCACGTTTGGTCGGTCTGCT
PCR reactions were performed as follow: 95 °C 4 min, (95 °C 45 s, 65 °C 45 s, 72 °C 1 min) 35 cycles, 72 °C 10 min.
The quantitative qPCR reaction was performed in triplicate using a QuantStudio 3 Real-Time System (Thermo Fisher Scientific, Waltham, MA, USA) using SYBR Green Supermix (Bio-Rad, Marne-la-Coquette, France). Relative mRNA expression of each gene was normalized to ube2a levels.
4
Western Blot and qRT-PCR Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Western blots, cells were lysed in radioimmune precipitation (RIPA) buffer and separated by SDS-PAGE. RIPA buffer consisted of 50 mM Tris–HCl, 150 mM NaCl, 0.5% (w/v) sodium deoxycholate, 1.0% (v/v) NP-40, 1.0 mM EDTA, 0.1% (w/v) SDS, and 0.01% (w/v) sodium azide at a pH of 7.4. A 100X Protease and phosphatase inhibitor cocktail was added to RIPA buffer just before use. G0S2 antibody (12,091-AP) was purchased from ProteinTech and the actin antibody was from Thermo Fisher (MA1–744). For real-time PCR, total cellular RNA was isolated using the RNeasy Mini Kit (Qiagen), and complementary DNAs (cDNAs) were synthesized using High-Capacity cDNA Reverse Transcription Kit iScript Reverse Transcription Supermix (Thermo Fisher ScientificBio-Rad Laboratories). Quantitative real-time PCR assays were performed with PowerUp SYBR Green Master Mix iTaq Universal SYBR Green Supermix (Thermo Fisher ScientificBio-Rad Laboratories) and the QuantStudio 3 Real-time System (Thermo Fisher) normalized to GAPDH as described [39] (link). Primer sequences are available on request.
5
Epigenetic Regulation Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For western analysis, cells were lysed in radioimmune precipitation buffer and separated by SDS/PAGE. Antibodies to actin (MA1‐744; Thermo Fisher; Waltham, MA, USA), ubiquitin H2A‐K119 (3240; Cell Signaling Technology; Danvers, MA, USA), H3K27me3 (9733; Cell Signaling Technology), BMI1 (6964; Cell Signaling Technology), EZH2 (5246; Cell Signaling Technology), DNMT3B (ab2851; Abcam; Cambridge, UK), and DNMT1 (SC‐20701; Santa Cruz Biotechnology; Dallas, TX, USA) were used. Total cellular RNA was isolated using the RNeasy Mini Kit (Qiagen), and complementary DNAs were synthesized using iScript Reverse Transcription Supermix (Bio‐Rad Laboratories; Hercules, CA, USA). Quantitative real‐time PCR assays were performed with iTaq Universal SYBR Green Supermix (Bio‐Rad Laboratories) and the QuantStudio 3 Real‐time System (Thermo Fisher). In all cases, gene expression was normalized to β‐actin. Primers for RT‐PCR are provided in Table S1 .
6
qPCR Analysis of Neuronal Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Quant Studio 3™ Real Time System and QuantStudioTM Design & Analysis Software v1.5.2 (Thermo Scientific) were used for qPCR analysis. Primer pairs HPRT1, TGM2, SYN1, RET, DBH, DRD2, CHT and ACHE were selected (see Supplementary Data 3 ). Six biological replicates were performed for each cell culture condition of SH-SY5Y cells (undifferentiated, RA- and RA/PMA-differentiated cells). Each biological replicate was analysed in technical duplicates. No template controls were used for each primer set. For qPCR, 3 μl cDNA (corresponding to 38 ng RNA) and 17 μl MasterMix (PowerTrack™ SYBR Green Master Mix, Thermo Scientific) were mixed. Optimised conditions were applied for each primer pair (Supplementary Data 3 ). Each reaction was subjected to melting temperature analysis to confirm presence of specific singly amplified products (Supplementary Fig. 8 ). The primer efficiency was calculated using a dilution series of cDNA as template (Supplementary Data 3 ). Specific gene amplification was normalised to HPRT1 and quantification was performed using the 2−∆∆Ct method53 (link). To calculate the fold-change the geometric mean of undifferentiated cells was used. A two-tailed t-test between two conditions was used for calculation of p-values.
7
LCMV Infection Kinetics and T-Cell Response
8
Viral RNA Detection in Seropositive Stool Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stool samples collected from seropositive participants on or between their last seronegative and first seropositive time points during the first year of the pandemic (January 1-December 31, 2020) were tested for viral RNA. Detailed methods for stool viral RNA extraction, RT-PCR, and sequencing are provided in the S1 Appendix . Briefly, total nucleic acid was extracted from homogenized and filtered stool specimens and quantitative real time PCR (qRT-PCR) was performed using the QuantStudio 3 Real-Time system (Applied Biosystems) [22 (link)]. Full-length SARS-CoV-2 genome sequencing was attempted on all qRT-PCR-positive samples. Consensus sequences were called using iVar (version 1.0; parameters -q 20, -t 0.75, -m 20, -n N) [23 (link)]. Lineages were assigned using pangolin (version 2.3.8) [24 ]. Sequence alignments were performed with MAFFT (version 7.471) [25 (link)] and phylogenetic reconstruction performed with iqtree with 1000 ultrafast bootstraps [26 (link)]. Phylogeny was visualized using FigTree (version 1.4.4) [27 ]. Sequences used in phylogenetic analysis include 500 randomly selected global sequences from GISAID [28 (link)], the Wuhan1 reference genome, and the two genomes sequenced in this study (GISAID accession numbers EPI_ISL_2771497 and EPI_ISL_2771498).
9
Gene Expression Analysis in Erythroid Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from KU812 cells using an AllPrep DNA/RNA/Protein Midi Kit (Qiagen, Valencia, CA, USA); TRIzol reagent was used to extract RNA from primary erythroid progenitors. Subsequently, cDNA was generated using the high capacity reverse transcription kit (Applied Biosystems) and qPCR was performed in a QuantStudio 3 Real‐Time System using SYBR Green™ Master Mix (Applied Biosystems). The level of DNMT1, DNMT3A, DNMT3B, MECP2, HBG and HBB gene transcripts were determined using gene specific primers (Table SI ). To quantify GYPA (glycophorin A) and TFRC (transferrin receptor) gene expression, we used the RT2‐qPCR Primer system (Qiagen, Germantown, MD, USA). Relative quantification of gene expression was normalized to GAPDH as an internal control. Quantification of MIR29B was performed using the TaqMan miRNA assay (Applied Biosystems) according to the manufacturer's instructions and SNORD48 was used as endogenous control. The 2−ΔΔCt method was used for calculating the relative amount of target mRNA. All RT‐qPCR reactions were performed in triplicate, repeated at least 3 times, and always included a no‐template sample as a negative control. RT‐qPCR results are presented as average fold change of target gene in cells relative to Scr control, which was normalized to one.
10
Quantifying Gene Expression in Erythroid Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!