Middlebrook adc enrichment

Manufactured by BD

Sourced in United States

Middlebrook ADC enrichment is a laboratory product designed for the cultivation and growth of Mycobacterium species, such as Mycobacterium tuberculosis. It provides a specialized nutrient-rich medium that supports the selective isolation and enrichment of these slow-growing mycobacteria from clinical specimens.

Automatically generated - may contain errors

Lab products found in correlation

Middlebrook oadc enrichment, by BD (3 mentions) Middlebrook 7h9 broth, by BD (1 mentions) Parafilm m, by Amcor (1 mentions) Middlebrook 7h10 agar plates, by BD (1 mentions) Middlebrook 7h9 medium, by BD (1 mentions) Difco middlebrook 7h9 broth, by BD (1 mentions) Difco middlebrook 7h10 agar, by BD (1 mentions)

Spelling variants of this product

ADC enrichment (14 citations) Middlebrook ADC (9 citations) BBL ™ Middlebrook ADC Enrichment (4 citations) Middlebrook albumin dextrose catalase enrichment (ADC; (3 citations)

5 protocols using middlebrook adc enrichment

Engineered M. smegmatis Derivatives

Check if the same lab product or an alternative is used in the 5 most similar protocols

M. smegmatis mc² 155
(rpoB′637′A),
a derivative of M. smegmatis mc² 155 having a
chromosomal rpoB gene that encodes a derivative of RNAP
β subunit having a substitution corresponding to Eco β
R637A, was constructed using recombineering with targeting oligonucleotide
5′-GGCGGAGACGAACTCGACCTCGCCGCCCTTCTTGGCGACCATGACGCGGTCCTCGGTGAAGC
GGCCGTTCTC-3′ [procedures as in Murphy et al,., 2015 ; selected on Seven H11 agar (BD
Biosciences, Inc.) containing Middlebrook ADC enrichment (BD Biosciences,
Inc.), 0.5% glycerol, and 30 μg/ml D-AAP1; confirmed by PCR
amplification and sequencing or rpoB and
rpoC].
M. smegmatis ATCC 19420
(rpoB′526′Y)
and ATCC 19420
(rpoB′531′L),
ATCC 19420 derivatives having chromosomal rpoB genes that
encode RNAP β subunits having substitutions that correspond to
Eco β H526Y and Eco β
S5331L, were obtained as spontaneous Rif-resistant mutants (selected on
Seven H11 agar containing Middlebrook ADC enrichment, 0.5% glycerol,
and 50 μg/ml Rif; confirmed by PCR amplification and sequencing of
rpoB and rpoC].
Resistance and cross-resistance levels were determined in broth
microdilution assays (see above, “Growth-inhibitory
activities”), using final concentrations of 0.0015–50
μg/ml D-AAP or Rif.

Lin W., Mandal S., Degen D., Liu Y., Ebright Y.W., Li S., Feng Y., Zhang Y., Mandal S., Jiang Y., Liu S., Gigliotti M., Talaue M., Connell N., Das K., Arnold E, & Ebright R.H. (2017). Structural basis of Mycobacterium tuberculosis transcription and transcription inhibition. Molecular cell, 66(2), 169-179.e8.

+ Open protocol

+ Expand

Cultivation of Clinical M. avium Strains

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two strains (FM and TM) of clinically-isolated M. avium from our hospital were used. All strains were cultured using Middlebrook 7H9 broth with Middlebrook ADC enrichment (Becton, Dickinson and Company, Sparks, MD, USA) at 37 °C. In agar plate, strains were cultured on Middlebrook 7H10 agar with Middlebrook OADC enrichment (Becton, Dickinson and Company, Sparks, MD) at 37 °C for 14 days in 90% humidity. After incubation, colonies were counted as described before [22 (link)].

Shundo Y., On R., Matsumoto T., Ouchi H, & Fujita M. (2023). TNFR1 Mediated Apoptosis Is Protective against Mycobacterium avium in Mice. Microorganisms, 11(3), 778.

+ Open protocol

+ Expand

Propagation and Irradiation of Mycobacteroides abscessus

Check if the same lab product or an alternative is used in the 5 most similar protocols

A pure culture of Mycobacteroides abscessus ATCC 19977 (American Type Culture Collection, Manassas, VA, USA) (homotypic synonym Mycobacterium abscessus ATCC 19977) was propagated and maintained at − 80 °C, and the second passage was used for irradiation. The stock solution was cultured in 10 mL total volume of Middlebrook 7H9 broth (Becton Dickenson, Sparks, MD, USA) with 10% (v/v) Middlebrook ADC Enrichment (Becton Dickenson, Sparks, MD, USA) and glycerol (2 mL/L). The tube was shaker-incubated at 37 °C for 46 h to late-log phase. The suspension was washed 3 times in phosphate-buffered solution (PBS, pH 7.4) and diluted to the order of 10⁶ colony-forming units per 1 mL (CFU/mL) in PBS for irradiation. The remaining concentration of viable microorganisms was determined using a CFU assay. One hundred microlitres of the irradiated solution was spread-plated in duplicate onto Middlebrook 7H10 agar plates (Becton Dickenson, Sparks, MD, USA) containing 10% (v/v) Middlebrook OADC Enrichment (Becton Dickenson, Sparks, MD, USA) and glycerol (5 mL/L). Plates were wrapped in Parafilm^® “M” (Bemis, Neenah, WI, USA) and incubated at 37 °C in the dark. Colonies were enumerated after 7 days.

Song J.J., Oguma K, & Takizawa S. (2023). Inactivation kinetics of 280 nm UV-LEDs against Mycobacterium abscessus in water. Scientific Reports, 13, 2186.

+ Open protocol

+ Expand

Microbial Antimicrobial Susceptibility Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mycobacterium smegmatis was grown in Middlebrook 7H9 medium supplemented with Middlebrook ADC enrichment (Becton Dickinson), 0.5% v/v glycerol and 0.05% w/v Tween80. E. coli was cultured in LB medium. Staphylococcus aureus was cultured in MH broth. We determined MICs against M. smegmatis mc 2 155, E. coli JW5503 and S. aureus using a broth microdilution assays. The compound was tested as a two-fold serial dilution at a starting concentration of 100 µM (final DMSO concentration of 2%). Growth was measured by OD and MIC 90 was recorded at the lowest concentration of compound which inhibited growth by 90% compared to controls.

Barman S., & Parish T. (2020). A novel benzoxaborole works by targeting FabI in Escherichia coli.

+ Open protocol

+ Expand

Recombinant BCG Vaccine with MyHCα Epitope

Check if the same lab product or an alternative is used in the 5 most similar protocols

Oligonucleotides that encode a 16-amino-acid MyHCα CD4⁺ T-cell epitope (aa 614–629; SLKLMATLFSTYASAD) were chemically synthesized. The sequences were 5′-TCGAGTCTGAAGCTGATGGCGACCCTGTTCTCGACCTACGCGTCGGCGGAT-3′ for the upper strand and 5′-TCGAATCCGCCGACGCGTAGGTCGAGAACAGGGTCGCCATCAGCTTCAGAC-3′ for the lower strand with cohesive ends of the XhoI recognition site (underlined) at both terminals of each DNA. The DNA oligomers were cloned into an XhoI site in the coding region of the Ag85B gene from M. kansasii cloned into pSO246 to be fused with the gene, and the generated plasmid was named pSO246-MyHCα. pSO246-MyHCα and pSO246 (empty plasmid: control) vectors were introduced into M. bovis BCG Tokyo 172 strain by electroporation, giving rise to rBCG-MyHCα and rBCG-pSO246, respectively. These transformants were selected on a Difco Middlebrook 7H10-agar (BD) plates containing Middlebrook OADC enrichment (BD) and 30 μg/mL kanamycin and grown in Difco Middlebrook 7H9-broth (BD) containing Middlebrook ADC enrichment (BD) and 0.05 Tween 80 at 37 °C for 2 weeks. After harvesting, rBCG was washed twice with PBS and then used for immunization.

Tajiri K., Imanaka-Yoshida K., Tsujimura Y., Matsuo K., Hiroe M., Aonuma K., Ieda M, & Yasutomi Y. (2021). A New Mouse Model of Chronic Myocarditis Induced by Recombinant Bacille Calmette–Guèrin Expressing a T-Cell Epitope of Cardiac Myosin Heavy Chain-α. International Journal of Molecular Sciences, 22(2), 794.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!