Abi bigdye terminator v3

From our Discovery set a total of 30 candidate mutations, were selected for validation by Sanger sequencing (Supplementary Table 4). For the Prevalence set, recurrent variants and top 5 most frequently mutated genes were selected for Sanger validation. Somatic or germline status was also determined by Sanger sequencing, where matched blood DNA was available (Supplementary Table 9). Primers specific to the regions of interest harboring the mutations were designed using Primer 3 software (http://www.bioinformatics.nl/primer3plus) and these sequences are listed in Supplementary Table 5. Due to sample limitation, DNA samples from TSH were whole genome amplified using Repli-G Mini kit (Qiagen, GmbH, Germany) prior to use for further PCR amplification for Sanger sequencing. PCR amplification was conducted using Platinum Supermix (Invitrogen, CA, USA) for samples from TSH, or GoTaq Green Master Mix (Promega, Madison USA) for samples from KLH, PH, SGH and QESH. PCR cycling parameters included one cycle at 95 °C for 5 min, 40 cycles at 95 °C for 30 s, 55 °C to 60 °C for 30 s and 72 °C for 1 min, and one cycle at 72 °C for 10 min. Sequencing was performed with ABI BigDye Terminator v3.1 (Life Technologies, CA, USA). The sequence chromatograms were visually inspected with Mutation Surveyor v4.0.4 (Softgenetics, State College, USA), Chromas Lite 2.1.1 or Bioedit software.

RNA was extracted from peripheral blood using RNAeasy Mini kit (Qiagen, Manchester, UK). cDNA was synthesized with SuperScript III First‐Strand Synthesis System (Invitrogen, Thermo Fisher Scientific, Paisley, UK) using random hexamers and the extracted RNA as a template. cDNA was used as a template in a polymerase chain reaction with specific primers targeting the potential splice‐site mutation (CFH exon 20 [F‐TATAA GGCGGGTGAGCAAGT] and CFH exon 23[AACTGATTCACCTGTTCTCG]). Polymerase chain reaction products were separated on a 2% TBE agarose gel and sequenced using ABI Big Dye Terminator v3.1 on an ABI 3500 Genetic Analyzer (Life Technologies, Thermo Fisher Scientific).

PCR amplification was performed using specific primers of EHV2 and EHV5, as summarized in (Table 3). Each PCR reaction was performed using a KAPA Taq PCR kit with 2 µL (10 µM) of each of the two selected primers, 5 μL of 10XKAPA Taq buffer, 1 μL of dNTP mix (0.2 mM), 0.2 μL of Taq polymerase (0.02 U/μL), 2 μL of DNA extract and nuclease-free water in a final volume of 50 μL. Amplification was carried out in a Bio-Rad T100 thermal cycler (Hercules, CA, USA), using the following reaction steps: an initial denaturation step of 95 °C for 5 min, followed by 40 cycles of amplification, using denaturation at 95 °C for 30 s, annealing at 61 °C for 45 s, extension at 72 °C for 1 min and final extension at 72 °C for 10 min. As a negative control, nuclease-free water was used. The final specific PCR products were visualized using 1.5% agarose gel electrophoresis. The gels were examined for specific size bands using a Gel Doc 2000 system (Bio-Rad). Samples were sequenced using ABI BigDye^® Terminator v3.1 (Applied Biosystems) on an ABI PRISM^® 3100 Genetic Analyzer (Applied Biosystems).