For evaluation of the prevalence of fimH, papA, papC, afa, csgA, tsh, hlyD, sitA, ibeA, malX, and iss genes in UPECs, we used the genomic DNA of the isolates, which was extracted by the boiling method in the previous step. Three multiplex PCR processes were designed for groups of fimH, papA, and malX genes, papC, afa, and csgA genes, and tsh, hlyD, ibeA, and sitA genes. The iss gene was amplified by uniplex PCR. The primer sequences and the PCR conditions for the detection of these virulence genes are shown in Table 1 . Finally, all the PCR products were electrophoresed on a 1% agarose gel (Parstous, Iran) which contained Safe Stain (YTA, Iran), and visualized using a UV-transilluminator (UVitec, Cambridge, UK).
Uv transilluminator
Manufactured by Uvitec
Sourced in United Kingdom
A UV transilluminator is a laboratory instrument that uses ultraviolet light to visualize and analyze DNA or protein samples after electrophoresis. It provides a consistent and reliable means of detecting and documenting the results of gel-based separation techniques.
Automatically generated - may contain errors
Lab products found in correlation
Pcr master mix, by Ampliqon (1 mentions)
Chemiluminescent nucleic acid detection module kit, by Thermo Fisher Scientific (1 mentions)
Lightshift chemiluminescent emsa kit, by Thermo Fisher Scientific (1 mentions)
Anaerobic chamber, by Coy Laboratory Products (1 mentions)
Xcell surelock mini cell, by Thermo Fisher Scientific (1 mentions)
Nupage 4 12 gradient gel, by Thermo Fisher Scientific (1 mentions)
Sypro ruby stain, by Bio-Rad (1 mentions)
Hrp conjugated anti rabbit secondary antibody, by Santa Cruz Biotechnology (1 mentions)
High pure nucleic acid kit, by Roche (1 mentions)
Genelute mammalian total rna miniprep kit, by Merck Group (1 mentions)
M mlv reverse transcriptase, by Top-Bio (1 mentions)
Geneq thermal cycler, by Bioer (1 mentions)
Thermal cycler instrument, by Eppendorf (1 mentions)
Epitect fast bisulfite conversion kit, by Qiagen (1 mentions)
Taq dna polymerase master mix, by Ampliqon (1 mentions)
11 protocols using uv transilluminator
1
Prevalence of Virulence Genes in UPECs
2
Two-step PCR for 18S rRNA detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A two-step semi-nested PCR protocol for the 18S rRNA gene was performed. The outer forward primer 5′-GGA AGG GTT GTA TTT ATT AGA TAA AG-3′ and common reverse primer Cr 550 5′-TGA AGG AGT AAG GAA CAA CCT CC-3′ were described previously (9 (link)). They amplified a ∼835-bp fragment applying the following procedure: 95 °C for 5 min followed by 25 cycles of 94 °C for 40 sec, 53 °C for 30 sec, and 72 °C for 45 sec, and the last extension of 72 °C for 5 min. The second round was performed using the forward primer Cr250 5′-GGA ATG AGT KRA GTA TAA ACC CC-3′ and the reverse primer Cr 550 5′-TGA AGG AGT AAG GAA CAA CCT CC-3′ that could amplify a region with ∼530 bp. The second PCR reaction used 95 °C for 5 min, followed by 35 cycles of 94 °C for 35 sec, 55 °C for 30 sec, and 72 °C for 40 sec, and over a final extension step at 72 °C for 5 min. Amplification done in final volume of 25 μL, containing 12.5 μL of 2X PCR master mix (Ampliqon, Denmark), 10.5 pM of each primer, and 2 μL of DNA using Biorad thermocycler. A sample excluding DNA as negative and a known C. parvum as positive controls were added in each set of PCR. The PCR product was transferred to a 1.5% agarose gel, electrophoresed for 1 h. The gel was stained with safe green and the products were visualized under a UV transilluminator (Uvitec, UK).
3
Electrophoretic Mobility Shift Assay for OrpR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA fragment containing the OrpR binding site was amplified by PCR with the biotin‐labeled primers prom2107b and prom2107comp shown in Table S2 . EMSAs were performed using lightShift Chemiluminescent EMSA Kit (Thermo Scientific). The different redox states of OrpR were incubated at room temperature in 10 mM Tris pH 7.5, 100 mM KCl, 50 ng/µl poly(dI‐dC), and 0.05% Nonidet P‐40 binding buffer with 5 fmoles of the biotin‐labeled DNA fragment for 30 min. Reactions were then resolved by a pre‐run electrophoresis in a 5% agarose gel in TBE buffer (450 mM Tris, 450 mM borate, and 0.01 mM EDTA). The samples were blotted onto a 0.45‐µm Biodyne B nylon membrane and then cross‐linked to the membrane using a 312 nm UV Transilluminator (Uvitec) for 1 min. Membranes were processed as recommended in the Chemiluminescent Nucleic Acid Detection Module Kit (ThermoScientific). For EMSAs in presence of as‐purified OrpR with or without DCPIP, all steps described previously were performed in an anaerobic chamber (COY Laboratory Products or MBraun). O2‐treated OrpR was obtained by incubating as‐prepared OrpR 30 min under aerobic conditions before incubation. EMSAs experiments with O2‐treated OrpR were performed in aerobic conditions.
4
Molecular Detection of Cryptosporidium via PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cryptosporidium oocysts were identified using a small-subunit rRNA-based on nested PCR, as described by Xiao et al. (19 (link)). Primary PCR was performed by primers SSU-F2: (5 TTCTAGAGCTAATACATGCG 3) and SSU-R2: (5 CCCATTTCCTTCGAAACAGGA 3) (19 (link)-22 (link)). The primary PCR mixtures contained 10 µL of template, 10X PCR buffer, 10 mM deoxynucleoside triphosphate mix (dNTP), 3 mM MgCL2, 50 pmol of each primer, and 0.3 U of Taq DNA polymerase in a 50 µL reaction volume. The secondary PCR was performed using the following primers SSU-F3: (5 GGAAGGGTTGTATTTATTAGATAAAG 3) and SSU-R4: (5 CTCATAAGGTGCTGAAGGAGTA 3) (21 (link)).
The reaction conditions were similar to those described above in the primary PCR, except that 5 μL product of the previous PCR was used as the template. Thermocycling parameters were 4 minutes at 94°C hot start (initial heat activation step), followed by 35 cycles of 45 seconds at 94°C, 90 seconds at 58°C and 1 minute at 72°C, with a final extension of 7 minutes at 72°C (19 (link)). The PCR product was loaded on 1% agarose gel, electrophoresed for 1 hour. The gel was stained with ethidium bromide and the products were visualized under a UV transilluminator (Uvitec, UK). The size of the amplicon was approximately 830 bp.
The reaction conditions were similar to those described above in the primary PCR, except that 5 μL product of the previous PCR was used as the template. Thermocycling parameters were 4 minutes at 94°C hot start (initial heat activation step), followed by 35 cycles of 45 seconds at 94°C, 90 seconds at 58°C and 1 minute at 72°C, with a final extension of 7 minutes at 72°C (19 (link)). The PCR product was loaded on 1% agarose gel, electrophoresed for 1 hour. The gel was stained with ethidium bromide and the products were visualized under a UV transilluminator (Uvitec, UK). The size of the amplicon was approximately 830 bp.
5
SDS-PAGE Protein Separation and Visualization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Supernatants (25 μl) containing GBPs of each sample together with 5 μl of marker were loaded onto SDS-PAGE gels, respectively. SDS-PAGE was conducted in Nu-PAGE 4-12% gradient gels (Invitrogen) via MOPS-Tris-SDS buffer system containing (50 mM MOPS, 50 mM Tris, 0.1% SDS and 1 mM EDTA) and operated at 20 mA constant current per gel in an Xcell SureLock™ Mini Cell (Invitrogen). After electrophoresis, gels were stained by Sypro Ruby stain (Bio-Rad) following the manufacturer’s instructions, and then visualized under a UV transilluminator (Uvitec, UK). MagicMark™ XP Western Standard protein ladders (Invitrogen) were used to estimate the molecular weight of protein bands.
6
Western Blot Analysis of LIMK1/2 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Control and LIMK1/2 dsRNA injected embryos were washed in PBS-PVA and placed at −80°C without medium before performing western blot. Embryos were contained in 1× sample sodium dodecyl sulfate buffer at 100°C for 10 min. Proteins were solubilized by electrophoresis and then separated on 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis gel and transferred to polyvinylidene fluoride membranes. Next, membranes were blocked in 1× triton-X–tris-buffer saline (TBS-T) with 5% skim milk for 1 h. Blocked membranes were contained in primary antibody (Rabbit Anti-LIMK; 1:1,000) placed at 4°C for overnight. Washed membranes were incubated for 1 h with HRP-conjugated anti-rabbit secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:1,000). Signals were detected by UV transilluminator (UVITEC Cambridge, Cambridge, UK).
7
Cytotoxicity Evaluation of P26 and P7 Peptides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The potential cytotoxic activity of P26 and P7 peptides against breast cell lines was studied by DNA fragmentation assay (15 (link)). DNA fragmentation assay is a hallmark of apoptosis in many cell types. The 2 × 106 cells per ml were incubated with two kinds of peptides at CC50 concentration for 48 h. After stimulation, the cells were washed twice with Phosphate Buffer Solution (PBS). DNA was purified from the cells with High Pure Nucleic acid Kit (Roche, USA) according to the standard protocol. Purified DNA was re-suspended in loading dye (Fermentas R0611) and run on 1.8 % agarose gel in 1X TAE buffer. DNA fragmentation was visualized under UV transilluminator (Uvitec, England).
8
Quantitative Gene Expression Analysis via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative expression levels of genes of interest were studied using RT-PCR, and total RNA for this purpose was extracted using the GenElute™ Mammalian Total RNA Miniprep kit (Sigma-Aldrich). RNA concentration and purity were determined spectrophotometrically, and equal amounts of RNA were reverse transcribed into cDNA using M-MLV reverse transcriptase (Top-Bio, Prague, Czech Republic). RT-PCR was carried out in 20-μL reaction volumes using the GeneQ thermal cycler (BIOER). To ensure that the amplification does not reach a saturation plateau, the suitable number of cycles for analysis of each gene in question was selected on the basis of comparison of RT-PCR products after 25, 30, 35 and 40 cycles of reaction (S1 Fig ). According to this initial analysis, expression level of each gene was semi-quantified after the 30 cycles of reaction, i.e. in the exponential phase of amplification. The products were subsequently separated with 1% agarose gel electrophoresis and visualized in a UV transilluminator (UVITEC Cambridge). Visualized transcript bands were quantified using ImageJ. The reference genes HSP90AB1 and GAPDH were used as an endogenous control. Data were analyzed using one-sample T-test (two-tailed); p< 0.05 was considered statistically significant. The primers used in this study are listed in Table 2 .
9
Methylation-Specific PCR Analysis of PTEN Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA (1 μg) of micro-dissected tumor tissues was extracted by the MagMA FFPE DNA Isolation Kit (Invitrogen, Carlsbad, USA) according to the manufacturer’s protocol. Bisulfite modification was performed by EpiTect Fast Bisulfite Conversion Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. MSP was performed using 100 ng of bisulfite-modified DNA, primers set and Taq DNA Polymerase Master Mix (Ampliqon, Copenhagen, Denmark) in a final volume of 25 μl in thermal cycler instrument (Eppendorf, Hamburg, Germany). MSP were analytically validated using standard methylated DNA as positive control (Chemicon, Temecula, USA) and primary keratinocyte DNA as negative controls. The amplification products were electrophoresed on a 2.5 % agarose gel, stained in sybr green, and visualized by UV transilluminator (Uvitec, Cambridge, UK). The MSP results were reported as methylated samples (a band 173 bp) and unmethylated samples (a band 155 bp). MSP results of PTEN promoter were also confirmed by bisulfite sequencing.
10
Fungal DNA Amplification and Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The rDNA gene was amplified, using the two primers ITS1 (5´-TCC GTA GGT GAA CCT GCG G-3´) and ITS4 (5´-TCC TCC GCT TAT TGA TAT GC-3´) (Gene Fanavaran., Iran) based on the protocol described by Ferrer et al. (13 (link)) with some minor modifications. A total of 3 µL of purified DNA was used as the template for PCR (BIO-RAD, Germany). The PCR reaction volume was 50 μL containing 25 pmol of each primer, 3 mM MgCl2, 200 µM dNTPs, and 2.5 U Taq DNA polymerase (Cinagen, Tehran, Iran) in 10x reaction buffer. The PCR cycling conditions included 95˚C for five minutes (1 cycle), 95˚C for 30 seconds, 55˚C for one minute, 72˚C for one minute (35 cycle), and 72˚C for six minutes (1 cycle). After amplification, a volume of 10 µL of the PCR product was run on 1% agarose gel by electrophoresis and bands were visualized using a UV trans-illuminator (Uvitec, United Kingdom). A negative control (sterile water) was used in each of the reactions. Finally, PCR amplified fragments were sequenced (Macrogen, Korea). The deduced sequence was subjected to the Basic Alignment Search Tool (BLAST) for the closet match in the database (14 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!