For qRT–PCR 25-ml cultures were inoculated with a preculture to an OD600 of 0.05 and grown for 6 h. Cells were immediately harvested and RNA stabilized by addition of 2 × vol. RNAprotect bacteria reagent (Quiagen). After centrifugation the supernatant was removed, and the pellet was quickly frozen with liquid N2.Then the pellets were resuspended in 1 ml TRIZOL solution (Invitrogen—Life Technologies Corporation, Darmstadt, Germany) and lysed with 0.3 ml zirconia-silica beads (Karl Roth GmbH, Karlsruhe, Germany; 0.1-mm diameter) in a high-speed benchtop homogenizer (FastPrep-24, MP Biomedicals, Germany). The lysed samples were mixed with 200 μl chloroform followed by centrifugation for 15 min at 4 °C and 15 000 r.p.m. The clear layer was transferred to a new tube and mixed with 500 μl isopropanol. After a further centrifugation and two washing steps with ethanol the RNA was carefully resuspended in RNAse-free water. To get rid of DNA contamination 5 μg ml−1 of each sample was mixed with 2 μl DNAse I (DNase Treatment and Removal kit, Ambion, Life Technologies) and 1 μl recombinant RNasin ribonuclease inhibitor (Promega, Madison, WI, USA) and incubated for 30 min at room temperature. Then DNAse was inactivated by adding inactivation reagent (DNase Treatment and Removal kit, Ambion, Life Technologies and RNA concentration was analysed.
Dnase treatment and removal kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The DNase treatment and removal kit is designed to efficiently remove DNase from RNA samples. The kit utilizes a simple and effective method to eliminate DNase activity, ensuring the integrity and purity of the extracted RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Recombinant rnasin ribonuclease inhibitor, by Promega (1 mentions)
Rnaprotect bacteria reagent, by Qiagen (1 mentions)
Trizol solution, by Thermo Fisher Scientific (1 mentions)
Fastprep 24, by MP Biomedicals (1 mentions)
Sybr green reagent, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis kit, by Thermo Fisher Scientific (1 mentions)
Q7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq with rox, by Takara Bio (1 mentions)
Direct zol rna miniprep kit, by Zymo Research (1 mentions)
2100 bioanalyzer, by Agilent Technologies (1 mentions)
Scriptseq complete kit, by Illumina (1 mentions)
In column dnase treatment, by Zymo Research (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Ds 11 spectrophotometer, by DeNovix (1 mentions)
High capacity reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
9 protocols using dnase treatment and removal kit
1
RNA Extraction from Bacterial Cultures
2
Gene Expression Analysis of Trisomic Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For gene expression studies, total RNA was isolated from the SCs using Trizol® following the manufacturer’s instructions (Thermo Fisher Scientific, MA). Genomic DNA was first removed using DNase Treatment and Removal Kit (Ambion). Purified RNA was quantified then reverse-transcribed into cDNA using high-capacity cDNA reverse transcription kit per manufacturer’s instructions (Thermo Fisher Scientific, MA). qRT-PCR was then carried out using SYBR® Green reagents (Thermo Fisher Scientific, MA) and validated QuantiTect® exon-spanning primers for genes of interest (Qiagen, GER) (primer sequences listed in Additional file 1 : Table S1). Trisomic and euploid samples from the same cohort were analyzed side by side to avoid batch errors. All values were first normalized to the housekeeping gene GAPDH, then presented as a relative quantity of euploid samples. Three to six mice from each genotypic group were used and data are shown as mean ± SE. A Student’s t test was used to assess significance at p < 0.05.
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from dissected tissues or cultured cells using Trizol reagent (Invitrogen, 15596-018), according to the manufacturer’s instructions. RNA was further purified by DNAse treatment and removal kit (Ambion, AM1906). Equal amount of total RNA was subjected to reverse transcription using SuperScript III First-Strand Synthesis kit (Invitrogen, 18080-051) as instructed. Real-time PCR was performed on a 7500 or Q7 real-time PCR system (Applied Biosystems) by using SYBR Premix Ex Taq with ROX (Takara, RR820B). For real-time PCR, primers used for gene expression are listed below: Dmp1, GGTGATTTGGCTGGGTC, TGTGGTCACTATTTGCCTGT; Gapdh, CCTCGTCCCGTAGACAAAATG, TCTCCACTTTGCCACTGCAA, Aqp4, TTTGGACCCGCAGTTAT, AAGGCGACGTTTGAGC;
The mRNA expression level was normalized to housekeeping gene GAPDH. Results are shown as mean ± SEM.
The mRNA expression level was normalized to housekeeping gene GAPDH. Results are shown as mean ± SEM.
4
RNA Extraction and Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from 2 x 106 cells using RNeasy Kit (Qiagen) and then further treated with DNase I by using DNase treatment and removal kit (Ambion). Real-time PCR was performed with SYBR green probe in an ABI Prism 7900 and the delta Ct method for relative quantitation. Primer sequences for RT-PCR are available upon request.
5
RNA Extraction and RNA-Seq of Burkholderia glumae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was conducted following the protocol previously established in our laboratory (Melanson, 2014 ). Briefly, overnight cultures of three biological replicates of each B. glumae strain were washed and diluted 100 times in fresh LB broth. Diluted cultures were routinely grown until the optical density reached OD600 = 1.0. One millilitre of each culture was pelleted and resuspended in 1 ml of TRIzol reagent (Ambion Life Technologies). Samples were stored at −70 °C before proceeding. Total RNA was extracted using the Direct‐zol RNA MiniPrep Kit with in‐column DNase treatment (Zymo Research) according to the manufacturer's instructions. A second DNase treatment was performed using the DNase Treatment and Removal kit (Ambion Life Technologies) to remove any residual DNA contamination. The resultant total RNA samples were sent to the Johns Hopkins University Genetic Resources Core Facility for subsequent RNA‐Seq steps including ribosomal RNA depletion, library construction, and sequencing. RNA quality was accessed by a 2100 BioAnalyzer (Agilent Technologies), and the RNA‐Seq libraries were prepared with the ScriptSeq v. 2 RNA‐Seq Library Preparation Module of the ScriptSeq Complete Kit (Bacteria) (Epicentre). RNA sequencing was conducted on a single lane of Illumina HiSeq 2500, HCS v. 2.2.38, RTA v. 1.18.61 (Illumina, Inc.) to obtain 100 bp paired‐end reads.
6
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from 2 x 106 cells using RNeasy Kit (Qiagen) and then further treated with DNase I by using DNase treatment and removal kit (Ambion). RT-PCR was performed as previously described [45 (link)]. Real-time PCR was performed with SYBR green probe in an ABI Prism 7900 and the delta Ct method for relative quantitation. Primer sequences for RT-PCR are available upon request.
7
Chondrocyte Gene Expression Analysis
8
RNA isolation and expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from either 75 pairs of <1 day-old ovaries or 100 pairs of three-day old testes per biological replicate as described previously (Soshnev et al. 2008 (link)). Genomic DNA was removed using Invitrogen DNase treatment and removal kit (Cat# AM1906). Generation of cDNA was done using Applied Biosystems Reverse transcription kit (Cat# 4368814). Expression levels were normalized to RpL32 and to one of the replicates of Canton-S RNA. Primer sequences are listed in Table S3.
9
Robust RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Trizol-based protocol (Sigma-Aldrich, Taufkirchen, Germany). Isolated RNA samples were treated with DNase using the DNase treatment and removal kit (cat# AM1906, Invitrogen, Waltham, MA, USA) as per manufacturer’s protocol. RNA was then measured using Denovix DS-11 spectrophotometer (Denovix Inc., Wilmington, DE, USA), and both 260/230 and 260/280 ratios were detected for assessment of the purity of samples. RNA samples were then run on an agarose gel to view RNA bands and immediately reverse transcribed to cDNA using the high capacity reverse transcription kit (cat# 4368814, Applied Biosystems, Waltham, MA, USA) as per manufacturer’s protocol. cDNA were stored at − 20 °C until further assays.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!