Quantitative real time pcr system

Genomic DNA was isolated from human PBMCs using the Quick-DNA Miniprep Kit (#D3024, Zymo Research) and quantified using a NanoDrop spectrophotometer (NanoDrop Technologies). The genotypes of rs62324212 were determined using a specific TaqMan SNP genotyping probe (#4351379, Thermo Fisher) and TaqMan™ Universal PCR Master Mix (#4324018, Thermo Fisher Scientific) according to the manufacturer’s protocol, and allelic discrimination was conducted using a quantitative real-time PCR system (Applied Biosystems).

Mycelia were cultivated on solid CYM (solid complete yeast medium) and replacement media (equal quantities of agricultural waste such as wood chips of Populus simonii, Castanea mollissima, and Pyrus bretschneideri were used to replace the glucose in CYM media; the other ingredients remained the same) at 25 °C for 14 days. Subsequently, mycelia were collected with a spoon and frozen in liquid nitrogen. An Omega E.Z.N.A.® Fungal RNA Kit (Omega Bio-Tek, Norcross, GA, USA) was used to extract total RNA, and cDNA synthesis was carried out using a HiScript® III 1st Strand cDNA Synthesis Kit (+ gDNA wiper) (Vazyme, Nanjing, China). Sequences of the primers for the 10 PeLac genes and the reference gene are provided in Additional file 1: Table S1. A Quantitative Real Time PCR System (Applied Biosystems, USA) and Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) were used for RT-qPCR. Single product amplification was verified via the generation of a dissociation curve. Transcript levels were normalized to those of PeGpd (3- Phosphoglyceraldehyde dehydrogenase, P. eryngii genome Gene ID: HQ844045.1) and quantitated using the 2^−ΔΔCT method. Experimental data pertaining to three technical replicates performed in triplicate were analyzed.

Peripheral blood mononuclear cells (PBMCs) from peripheral blood of all subjects were isolated by Ficoll–Hypaque density gradient centrifugation method. Total cellular RNA was extracted using miRNeasy Mini Kit (Qiagen, Germany). The quantification and concentration of RNA were determined using NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, United States), and RNA was reverse transcribed into complementary DNA using a PrimeScript™ RT reagent kit (Takara Bio Inc., Japan). The FCRL5 mRNA expression levels were detected in the quantitative Real-Time PCR System (Applied Biosystems, Foster City, CA, United States) using the SYBR Green kit (Takara Bio Inc., Japan). The relative expression levels of FCRL5 mRNA were normalized to the internal control U6 and were calculated by 2^−ΔΔCT. The primer sequences of FCRL5 and U6 are as follows: FCRL5, forward: 5′-GTGCAAGTGTAGATGCCGACAA-3′; reverse: 5′- GTGCAAGTGTAGATGCCGACAA - 3′; U6, forward: 5′-CTCGCTTCGGCAGCACA-3′; reverse: 5′- AACGCTTCACGAATTTGCGT - 3′.