Big dye terminator chemistry version 1

PCR primers were designed using Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/). Primer set F1 targeted codon 546; primer set F2 targeted codons 655–658 of reference cDNA sequence NM_023110 with ATG_i as codon 1. All primers had binding sites in the introns flanking the exons containing the target codons. Primers sequences were: F1F tcaagtcccagggaaaagca; F1R gggcagggaaagccagtct; F2F gagccttccagctccctcac; F2R ccaccccactccttgcttct. PCR was carried out using HotStarTaq master mix (Qiagen) in 10 μl final volume using 40 pmol of each primer, 10% DMSO and 10 ng of DNA. Reaction conditions were 95°C for 15 min, 36 cycles of [95°C, 30 s; 58°C 30 s; 72°C, 30 s], followed by 72°C for 10 min and hold at 15°C. All samples were bi-directionally sequenced using Big- Dye terminator chemistry version 1.1 (Applied Biosystems). PCR primers were used for sequencing. Data collection was performed using an Applied Biosystems 3130xl Genetic Analyser. Data analysis was carried out by visual inspection of electropherograms and using Mutation Surveyor 3.2 (SoftGenetics).

PCR amplification of exon 61 of the USH2A gene was performed with genomic DNA with one set of primers (Table 1). All PCRs were performed in a 15 μL reaction mixture containing 30 ng purified genomic DNA, 200 nM of each of the primers and 1× Type-It HRM PCR Kit (Qiagen, Hilden, Germany). PCR reactions were optimized: 5 minutes at 95 °C, followed by 45 cycles as follows: 10 seconds at 95 °C, 30 seconds at 56 °C, and 10 seconds at 72 °C, with detection of the fluorescence on the Green channel. Melting temperature was raised from 65 °C to 95 °C with a ramp of 0.02 °C per second and the detection of fluorescence on the HRM channel. Rotor-Gene Q 5plex HRM was used to perform the reactions (Qiagen, Hilden, Germany). Analysis of the HRM results was conducted using Rotor-Gene Q Series Software, 2.0.2 (Qiagen, Hilden, Germany).
For Sanger sequencing, the PCR products obtained with the HRM analysis were directly used for a sequencing reaction after being purified with Diffinity Rapid Tips (Sigma Aldrich, Taufkirchen, Germany). The ABI Prism 310 capillary sequencer (Applied Biosystems, Foster City, CA, USA) was used for sequencing. The sequencing reaction was performed using Big-Dye terminator chemistry version 1.1 (Applied Biosystems, Foster City, CA, USA). Electropherograms were analyzed with the Sequencing Analysis 5.2.0 software (Applied Biosystems, Foster City, CA, USA).

Methylation status of the promoter region of NANOG was analyzed using Sanger sequencing after bisulfite conversion. Bisulfite conversion was performed using the innuCONVERT Bisulfite Basic Kit (Analytik Jena AG, Jena, Germany) according to the manufacturer's instructions using 500 ng of DNA.
PCR reaction contained 0.2 μl 5 μM primers (forward and reverse) (Sigma-Aldrich, Taufkirchen, Germany), 0.05 μl (5 units/μl) HotStarTaq Plus DNA Polymerase, 1 μl 10x PCR Buffer, 0.7 μl (3.33 mM) dNTPs, 6.35 μl ddH₂O (Qiagen, Hilden, Germany), and 15 ng bisulfite-converted DNA. Thermal conditions for PCR were as follows: 10 min at 95°C, 40 cycles of 1 min at 95°C, 1 min at 61°C, 1 min at 72°C, and final elongation for 10 min at 72°C. Primers used are listed in Additional file 1: Table S1.
Sanger sequencing was performed on SeqStudio Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). PCR products were directly used for a sequencing reaction after being purified with ExoSAP-IT™ PCR Product Cleanup Reagent (Applied Biosystems, Foster City, CA, USA), according to the manufacturer's instructions. The sequencing reaction was performed using Big-Dye terminator chemistry version 1.1 (Applied Biosystems, Foster City, CA, USA). Electropherograms were analyzed using the Sequence Scanner Software 2, Version 2.0 (Applied Biosystems, Foster City, CA, USA).