Log In Sign up
The largest database of trusted experimental protocols

Lentiviral vector

Manufactured by System Biosciences
Visit Supplier
Sourced in United States

Lentiviral vectors are a type of gene delivery system that utilizes modified lentiviruses, a subclass of retroviruses, to efficiently introduce genetic material into target cells. These vectors are designed to stably integrate the desired genetic payload into the host cell's genome, enabling long-term gene expression.

Automatically generated - may contain errors

Lab products found in correlation

Accuri c6, by BD (1 mentions) Plko 1 vector, by Addgene (1 mentions) Puromycin, by Thermo Fisher Scientific (1 mentions) G418 sulfate, by Thermo Fisher Scientific (1 mentions) Pgreenpuro shrna, by System Biosciences (1 mentions) Pcmv5 flag, by Merck Group (1 mentions)

Close spelling variants of this product

PCDH lentiviral vector (12 citations) PGreenPuro lentiviral vector (9 citations) PCDH lentiviral expression vector (8 citations) PCDH-CMV-MCS-EF1-copGFP lentiviral vector (6 citations) PCDH-CMV lentiviral vectors (4 citations) Lentiviral vector system (4 citations) PCDH-MCS-T2A-Puro-MSCV lentiviral vector (3 citations) PCDH-EF1-MCS-(PGK-copGFP) lentiviral expression vector (3 citations) PCDH-CMV-MCS-T2A-Puro lentiviral vector (3 citations) PCDH-puro lentiviral vector (3 citations)

4 protocols using lentiviral vector

1

Stably Expressing Mouse Fibrosarcoma FAP

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stably expressing mouse FAP clone MCA205-mFAP was generated by lentiviral vector (System Biosciences) transduction of MCA205 mouse fibrosarcoma cells (Sigma) and subsequent puromycin selection, in the manufacturer’s recommended medium. Puromycin resistance cells were then cloned by single cell dilution and FAP expression was screened by flow cytometry (Accuri C6, BD Biosciences). Cells were free of mycoplasma contamination.
Zboralski D., Osterkamp F., Christensen E., Bredenbeck A., Schumann A., Hoehne A., Schneider E., Paschke M., Ungewiss J., Haase C., Robillard L., Simmons A.D., Harding T.C, & Nguyen M. (2023). Fibroblast activation protein targeted radiotherapy induces an immunogenic tumor microenvironment and enhances the efficacy of PD-1 immune checkpoint inhibition. European Journal of Nuclear Medicine and Molecular Imaging, 50(9), 2621-2635.
+ Open protocol
+ Expand
2

Lentiviral Expression of IDH2 Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate lenti-virus, HEK-293T cells were transfected with 5μg DNA, 5μg psPAX2 packaging plasmid, and 500ng VSV.G envelope plasmid. pLKO.1 human SIRT3 shRNA was purchased from OpenBiosystem. pLKO.1 human IDH2 shRNA oligos (CCTCTCTGGAGGCCTTTCTAG) was purchased (IDT) and cloned into the pLKO.1 vector (Addgene). The human IDH2 expression vector, pCDNA3-Flag-IDH2, was used as the IDH2 wild-type (WT) and for mutagenesis. K413 was converted to Arginine (R: deacetyl mimic) or Glutamine (Q: acetyl mimic) by site-directed mutagenesis (Bioinnovatise). The lenti-viral IDH2 vector was generated by PCR amplification into two PCDH-CMV vectors (Lentiviral vector, System Biosciences). Cells were infected with 5 MOI of lenti-virus and selected in 2 μg/mL puromycin (Invitrogen) for 14 days or 100 μg/mL G418 sulfate (Invitrogen). Two-weeks, selection, cells were grown in standard DMEM. MCF7 cells were grown in high and low serum as a control to determine the relative level of mitochondrial acetylation (Supplemental Fig. S1).
Zou X., Zhu Y., Park S.H., Liu G., O’Brien J., Jiang H, & Gius D. (2017). SIRT3-mediated dimerization of IDH2 directs cancer cell metabolism and tumor growth. Cancer research, 77(15), 3990-3999.
+ Open protocol
+ Expand
3

TARBP2 Plasmid Construction and Knockdown

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The pLPC-TARBP2 plasmid was kindly provided by Dr Sonia A. Melo and then subcloned into the vectors pCMV-Tag2b and pCMV-myc. The Flag-TARBP2 was cloned into the lentiviral vector (System Biosciences, Mountain View, CA, USA) carrying EGFP and Puromycin genes28 (link)46 (link). The TARBP2 cDNA was cloned into the prokaryotic expression vector pGEX4T1. The shRNA sequence targeting human TARBP2 3′-UTR (TARBP2sh) was obtained from Sigma ‘Mission shRNA' online: 5′-TCATGGATGTGCACCCTTTG-3′ at 1,604 site. The shRNA was cloned into pLKO.1 vector or pGreenPuro shRNA (System Biosciences). The oligo sequences of other shRNAs including Senp1sh1, Senp1sh2 and SUMO1sh are listed in Supplementary Table 2.
Chen C., Zhu C., Huang J., Zhao X., Deng R., Zhang H., Dou J., Chen Q., Xu M., Yuan H., Wang Y, & Yu J. (2015). SUMOylation of TARBP2 regulates miRNA/siRNA efficiency. Nature Communications, 6, 8899.
+ Open protocol
+ Expand
4

Molecular Cloning and Mutagenesis of SIRT2 and PKM2

Check if the same lab product or an alternative is used in the 5 most similar protocols
pLKO.1 human SIRT2 shRNA was generated as AAGTAGTGACAGATGGTTGGC. pLKO.1 human and mouse PKM2 shRNA were generated as CATCTACCACTTGCAATTA and GTGCACTCCACTTCTGTCACT, respectively. pCMV5-Flag-SIRT2 was generated by standard PCR amplification of SIRT2 followed by cloning into the pCMV5-Flag (Sigma). The human SIRT2 and PKM2 genes were cloned into PCDH-CMV vectors (Lentiviral vector, System Biosciences; CD513B-1). Plasmids encoding Flag (DYKDDDDK)-tagged PKM2 (Open Biosystems) were purified and subjected to site-directed mutagenesis (BioInnovatise). WT amino acids (K62 and K305) were either converted to arginine (R) or glutamine (Q). Functionally inactive SIRT2 was created by conversion of H187 (Addgene) to tyrosine (Y).
Park S.H., Ozden O., Liu G., Song H.Y., Zhu Y., Yan Y., Zou X., Kang H.J., Jiang H., Principe D.R., Cha Y.I., Roh M., Vassilopoulos A, & Gius D. (2016). SIRT2-mediated deacetylation and tetramerization of pyruvate kinase directs glycolysis and tumor growth. Cancer research, 76(13), 3802-3812.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!