RNA extraction and reverse transcription were performed using a Trizol Kit (Invitrogen) and a Superscript III kit (Invitrogen) according to the manufacturer’s protocol. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) for miR-125a-5p was performed using a TaqMan miRNA qRT-PCR assays (Applied Biosystem, Waltham, MA, USA) on an ABI-Prism 7300 System (Applied Biosystem) according to the manufacturer’s protocol. U6 transcript was used as internal control. qRT-PCR on NAIF1 and caspase-3 genes was performed using a SYBR Green PCR Master Mix kit (Applied Biosystem), also on the ABI-Prism 7300 System, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as internal control. The (2−ΔΔCT) method was used to quantitatively compare gene expression levels between samples.
Taqman mirna qrt pcr assay
Manufactured by Thermo Fisher Scientific
Sourced in United States
TaqMan miRNA qRT-PCR assays are a set of reagents designed for the detection and quantification of microRNA (miRNA) expression levels using real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) technology. The assays utilize TaqMan probe-based detection to provide sensitive and specific measurement of mature miRNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Abi prism 7300 system, by Thermo Fisher Scientific (2 mentions)
Epoch spectrophotometer, by Agilent Technologies (2 mentions)
Siport neofx transfection reagent, by Thermo Fisher Scientific (2 mentions)
Mirneasy mini kit, by Qiagen (2 mentions)
Cellstar six well dishes, by Greiner (2 mentions)
Trizol kit, by Thermo Fisher Scientific (1 mentions)
Superscript 3 kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix kit, by Thermo Fisher Scientific (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Mirna specific rt primers, by Thermo Fisher Scientific (1 mentions)
C1000 touch thermal cycler, by Bio-Rad (1 mentions)
Reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
7500ht real time pcr system, by Thermo Fisher Scientific (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
6 protocols using taqman mirna qrt pcr assay
1
Gene Expression Analysis by qRT-PCR
2
Quantitative Expression Analysis of miR-128
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of miR-128 was evaluated using qRT-PCR. Briefly, total RNA was extracted from tissues or cells using RNeasy kits (QIAGEN, Valencia, CA, USA). RNA was reversely transcribed into cDNA using miRNA-specific RT primers (Thermo Fisher Scientific Inc., Waltham, MA, USA). The used primer sequences (Invitrogen, Shanghai, China) were as follows: miR-128, 5′-TCCGATCACAGTGAACCGGT-3′ (forward) and 5′-GTGCAGGGTCCGAGGT-3′ (reverse); U6, 5′-CTCGCTTCGGCAGCACA-3′ (forward) and 5′-AACGCTTCACGAATTTGCGT-3′ (reverse). qRT-PCR was performed by a TaqMan miRNA qRT-PCR assays (Applied Biosystem, Waltham, MA, USA) with ABI-Prism 7300 System (Applied Biosystem, Waltham, MA, USA). Expression of miR-1258 was measured using 2−ΔΔCt as described previously [27 (link)].
3
Quantifying miR-424-5p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded into CELLSTAR six-well dishes (Greiner, Kremsmunster, Austria) at a density of 2 × 104 cells/mL for both cell lines. Cells were transfected with 2 μM pre-miR-424-5p (Cat. #PM17100, Ambion, Austin, TX, USA), or 2 μM pre-miR-Precursor Negative Control #1 (Cat. #AM17110, Ambion, Austin, TX, USA) using siPORT NeoFX transfection reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. RNA from a well of transfected cells was harvested using the Qiagen miRNeasy mini kit (Qiagen, Hilden, Germany). The RNA quantity and purity (OD 260/280 ratio) were accessed using the Epoch spectrophotometer (BioTek, Winooski, VT, USA). The expression of miR-424-5p compared to the control, RNU43, was analyzed using Taqman miRNA qRT-PCR assays according to the manufacturer’s instructions (assay ID: 000604 and 001095, Applied Biosystems, Foster City, CA, USA), using 5 ng of RNA per sample in a 20 μL reaction volume for RT. The resulting cDNA was quantified in a 20 μL reaction volume, assayed in triplicate, on the C1000 Touch Thermal Cycler using the CFX Maestro software v4.0.2325.0418 (Bio-Rad, Hercules, CA, USA). The normalization of miR-424-5p expression to RNU43 was conducted, using the comparative C(T) method [39 (link)]
4
Overexpression of let-7c-5p in Renal Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A hemocytometer (American Optical Corporation, Buffalo, NY, USA) was used to count cells and seed 786-O and Caki-1 into CELLSTAR six-well dishes (Greiner, Kremsmunster, Austria) at a density of 2 × 104 cells/mL. siPORT NeoFX transfection reagent (Invitrogen, Carlsbad, CA, USA) was used to deliver 2 μM pre-let-7c-5p (Cat. #AM17100, Assay ID PM10235, Ambion, Austin, TX, USA) or 2 μM pre-miR-Precursor Negative Control #1 (Cat. #AM17110, Ambion) at a final concentration of 20 nM to cells according to the manufacturer’s protocol. The Qiagen miRNeasy mini kit (Qiagen) was used to harvest RNA from transfected cells, and the Epoch spectrophotometer (BioTek, Winooski, VT, USA) was used to evaluate quality and purity (OD 260/280 ratio). Overexpression of let-7c-5p compared to control, RNU43, was conducted using Taqman miRNA qRT-PCR assays according to the manufacturer’s protocol (assay ID: 000379 and 001095, respectively, Applied Biosystems, Foster City, CA, USA). The comparative CT method was used to normalize let-7c-5p expression to RNU43 [36 (link)].
5
Validation of miRNA Profiling in APAP Toxicity
6
Quantification of miR-210 and HIF-1α in Urothelial Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miR-210 analysis, the TaqMan miRNA qRT-PCR assay (Applied Biosystems, Waltham, MA, USA) was used to quantify the levels of miR-210. The qRT-PCR was performed at 95° C for 20 s, followed by 40 cycles of 95° C for 5 s and 60° C for 35 s. The relative expression level of the miRNA was normalized to that of the internal control, RNU6B, by using the equation log (2-ΔCt), where ΔCt = (CtmiR-210 - Ct RNU6B) 17 (link).
For HIF-1α analysis, cDNA was synthesized using reverse transcriptase (Applied Biosystems, Waltham, MA, USA). HIF-1α expression levels were quantified using qRT-PCR, which was performed using Fast SYBR Green Master Mix (Applied Biosystems, Waltham, MA, USA) with specific oligonucleotide primers (HIF-1α primers: Forward TGTGACCATGAGGAAATGAGAGA; Reverse TTTTGTTCTTTACCCTTTTTCACAAG; GAPDH was used as the internal control, Forward: CCTGCACCACCAACTGCTTA; Reverse: GGGCCATCCACAGTCTTCTG). Expression was analyzed using 7500HT Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The fold change in HIF-1α expression in cancerous vs. non-cancerous urothelium was calculated by the comparative threshold count method, after normalization to the internal control, GAPDH. All experiments were performed in triplicate.
For HIF-1α analysis, cDNA was synthesized using reverse transcriptase (Applied Biosystems, Waltham, MA, USA). HIF-1α expression levels were quantified using qRT-PCR, which was performed using Fast SYBR Green Master Mix (Applied Biosystems, Waltham, MA, USA) with specific oligonucleotide primers (HIF-1α primers: Forward TGTGACCATGAGGAAATGAGAGA; Reverse TTTTGTTCTTTACCCTTTTTCACAAG; GAPDH was used as the internal control, Forward: CCTGCACCACCAACTGCTTA; Reverse: GGGCCATCCACAGTCTTCTG). Expression was analyzed using 7500HT Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The fold change in HIF-1α expression in cancerous vs. non-cancerous urothelium was calculated by the comparative threshold count method, after normalization to the internal control, GAPDH. All experiments were performed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!