Zymo rna clean and concentrator 5
The Zymo RNA Clean and Concentrator 5 is a purification kit designed to clean and concentrate RNA samples. It utilizes a silica-based membrane to selectively bind RNA, allowing for the removal of contaminants and the concentration of the desired RNA molecules.
Lab products found in correlation
5 protocols using zymo rna clean and concentrator 5
Mosquito Head RNA Extraction and Sequencing
Reverse Crosslinked RNA Adapter Ligation
In Vitro Transcription of Spike-in mRNA
m7G_CTCTTCCCATGGCCGCAGCCGCCGCCATCGTCGACGCGCGCTTCCCTGTTCACCTCTGACTCTGAGAATCCGTCGCCATCCGCCACCGGCGCGCCGCTAGCCACCATGACTTCGAAAGTTTATG.
Efficient mRNA Synthesis and Purification
For the comparing capped versus uncapped mRNA, uncapped RNA was incubated for 5 min at 65 °C to match the treatment of capped RNAs. The same RNA that was used in the vaccinia capping reaction was directly compared to the post-cap RNA.
M6A RIP Enrichment and Quantification
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!