Ion torrent proton system

GBS was conducted following the methods and recommendations outlined by Elshire et al. (2011) (link), Sonah et al. (2013) (link), and Torkamaneh et al. (2020a (link),c) (link). The GBS library was created with ApeKI restriction enzyme digestion. A 158 million single-end reads were generated with an Ion Torrent Proton System (Thermo Fisher Scientific Inc., USA). These were processed using the Fast-GBS.v2 pipeline (Torkamaneh et al., 2020c (link)). FASTQ files were demultiplexed, trimmed, and then mapped against the soybean reference genome (Williams82 (Gmax_275_Wm82.a2.v1); Schmutz et al., 2010 (link)) with an average success rate of 94.4%. SNPs were identified from the mapped reads and filtered out if (i) they were multi-allelic, (ii) the overall read quality (QUAL) score was <20, (iii) the mapping quality (MQ) score was <30, (iv) read depth was <2, and (v) missing data >80%. Missing data imputation was performed using BEAGLE v5.1 (Browning et al., 2018 (link)) following the protocol laid out by Torkamaneh and Belzile (2015) (link).

The DNA concentration of libraries was normalized to 80 pM and pooled before template preparation using the Ion OneTouch™ 2 System (Ion PI™ Hi-Q™ OT2 200 Kit and Ion PI™ v3 chips; Thermo Fisher Scientific). Sequencing was performed on the Ion™ Torrent Proton System (Thermo Fisher Scientific) with 520 flows, which typically resulted in ~80 M single-end reads and sequencing depth of 1 M reads per sample, which was sufficient for our in-depth analysis.
Sequencing data in FASTQ format were further processed using a dedicated MAGeCK (Model-based Analysis of Genome-wide CRISPR-Cas9 Knock-out, accession date: 02.12.2020) tool [25 (link)]. The generated count table contains raw abundances for targeting and non-targeting gRNA from 48 samples (typically about 170 k counts per sample). Follow-up analyses were performed using the dedicated packages from Bioconductor (https://www.bioconductor.org/, version 3.10 [26 (link)]) in R (https://www.r-project.org/, [27 ]), accession date: 26 March 2021).

Whole-exome sequencing was performed using DNA from the surgically resected specimen (AllPrep DNA/RNA Mini Kit; QIAGEN, Hilden, Germany). Gene-specific analysis was carried out using an Ion Torrent Proton system with Ion AmpliSeq Exome Kit (4487084; Life Technologies, Carlsbad, CA, USA) and analyzed using Ion Reporter software (Life Technologies).

Thirty-three locus-specific primer pairs of 17–21 nucleotides each were designed using the Sequenom MassArray Assay Design 4.0 software (Sequenom, San Diego, CA) with the amplicon length set at 150 nucleotides as the optimum, ranging from 80 to 200 nucleotides (S1 Table). The primers were modified (Fig 1) by adding barcodes and specific sequences compatible with the Ion Torrent Proton System (LifeTechnologies, Carlsbad, CA). The locus-specific forward primers for the first PCR were tailed with an M13 derived sequence (GATGTAAAACGACGGCCAGTG) at the 5’-end to enable the addition of barcoded adapters during the second round of PCR. The Ion truncated P1/B adapter sequence (CCTCTCTATGGGCAGTCGGTGAT) was concatenated to the 5’-end of the locus-specific reverse primers. For the second PCR, the forward fusion primer consisted of, from 5’ to 3’, the standard Ion A adapter sequence (CCATCTCATCCCTGCGTGTCTCCGACTCAG), a unique barcode with 10–12 nucleotides, followed by the M13 tail sequence. A combination of different barcodes with the M13 tail gave us the flexibility to multiplex the same set of markers in different samples. The reverse primer for the second PCR was the Ion truncated P1/B adapter sequence. Ninety-six unique barcodes from LifeTechnologies were used to tag the 24 wheat accessions under four different PCR conditions.

Each pool of 10 leaves was manually grounded with mortar and pestle under liquid nitrogen. Total RNA was extracted according to [28 (link)], treated with RQ1 RNAse-free DNAse (Promega), and purified with RNeasy Plant Mini Kit (Qiagen), following the manufacturer’s instructions. The integrity of the RNA was assessed in a 0.8% agarose gel, and its quantity and quality with a NanoDrop (ThermoFisher Scientific) and a BioAnalyzer 2100 Plant RNA Pico chip (Agilent) before proceeding with library preparation.
Mature mRNA was selected with Dynabeads mRNA DIRECT Micro Kit (ThermoFisher Scientific), adding ERCC RNA Spike-In Control Mix from the same manufacturer. Eight whole transcriptome libraries were constructed with Ion Total RNA-seq Kit v2 (ionTorrent, Life Technologies), followed by emulsion PCR in an Ion OneTouch 2 System, using the Ion PI Hi-Q OT2 200 Kit (ionTorrent, Life Technologies).
Sequencing was performed using the ionTorrent Proton System (Life Technologies), in a total of three runs (with three, three, and two libraries, respectively) in order to ensure approximately 25 million reads per library, which was shown to be sufficient to detect more than 90% of genes in eukaryotes [29 (link)].

The genomic sequences of Pst-specific SP genes containing SNPs among 14 whole-genome sequenced Pst isolates [37 (link)] identified using the IGV software (https://igv.org/app, accessed on 27 September 2020) were used to develop SP-SNP markers. The SP-SNP primers were designed using the Sequenom MassArray Assay Design 4.0 software (Sequenom, San Diego, CA, USA). The primers were modified by adding barcodes and specific sequences compatible with the Ion Torrent Proton System (LifeTechnologies, Carlsbad, CA, USA). The locus-specific forward primers for the first round of PCR were tailed with an M13-derived sequence (GATGTAAAACGACGGCCAGTG) at the 5′-end to enable the addition of barcoded adapters during the second round of PCR. The Ion truncated P1 adapter sequence (CCTCTCTATGGGCAGTCGGTGAT) was concatenated to the 5′-end of the locus-specific reverse primers (Table S5). For the second round of PCR, the forward fusion primer consisted of, from 5′ to 3′, the standard Ion A adapter sequence (CCATCTCATCCCTGCGTGTCTCCGACTCAG), a unique barcode with 10–12 nucleotides, followed by the M13 tail sequence (Table S5). A combination of different barcodes with the M13 tail proved the flexibility required to multiplex the same set of markers in different samples. The reverse primer for the second round of PCR was the Ion truncated P1 adapter sequence.