The in vitro cytotoxicity was determined by means of (4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method. In brief, HaCaT, 1BR3 cells were seeded in 96-well plates at an initial density of 1104 cells/well and allowed to attach. Next, the old medium was removed and a fresh one was added containing five concentrations (100 µM, 10 µM, 1 µM, 0.1 µM, and 0.01 µM) of the tested compounds 6 and 7 after which cells were incubated for 48 h. The control cells were treated with the same amount of DMSO, the highest concentration of DMSO present in the medium being 0.5%. A volume of 10 mL MTT reagent (5 mg/mL) was added in each well. During a 4 h contact period, the intact mitochondrial reductase converted and precipitated MTT as blue crystals. The precipitated crystals were dissolved in 100 mL of lysis solution provided by the manufacturer (Sigma-Aldrich). Finally, the reduced MTT was spectrophotometrically analyzed at 570 nm, using a microplate reader (xMark Microplate Spectrophotometer, Bio-Rad, Hercules, CA, USA). GI50 was calculated for each healthy cell line.
Lysis solution
Manufactured by Merck Group
Sourced in Germany, Spain
Lysis solution is a laboratory reagent used to disrupt the cell membranes and walls of cells, releasing the cellular contents. It is a key component in the process of sample preparation for various analytical techniques.
Automatically generated - may contain errors
Lab products found in correlation
Xmark microplate spectrophotometer, by Bio-Rad (2 mentions)
Sodium succinate, by Merck Group (2 mentions)
Rpmi 1640 medium, by Merck Group (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Collagenase 1, by Thermo Fisher Scientific (1 mentions)
Lsr 2, by BD (1 mentions)
Precision count beads, by BioLegend (1 mentions)
Anti cd16 32 blocking antibody, by BioLegend (1 mentions)
Big dye protocol, by Thermo Fisher Scientific (1 mentions)
Lipofectamine crisprmax cas9 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Mammalian genomic dna miniprep kit, by Merck Group (1 mentions)
Cas9 protein, by Thermo Fisher Scientific (1 mentions)
Kapa2g taq polymerase, by Roche (1 mentions)
Neutralization buffer, by Merck Group (1 mentions)
Genelute mammalian total rna miniprep kit, by Merck Group (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
12 well dishes, by Corning (1 mentions)
Iscript reverse transcription supermix for rt qpcr, by Bio-Rad (1 mentions)
Imagequant tl 8, by GE Healthcare (1 mentions)
15 protocols using lysis solution
1
Cytotoxicity Assessment of Compounds
2
THP1 Cell Stimulation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used the THP1 cell line for stimulation experiments. After the recovery of cells from a deep-frozen state, we used the protocol published earlier 45 (link),46 (link). The cells were stimulated for 3 h in the RPMI 1640 medium (Sigma Aldrich) containing 10% of a plasma sample. The cells were collected after 3 h of cultivation; after centrifugation, the supernatant was removed, and the cells were preserved in lysis solution (Sigma-Aldrich) and stored at − 80 °C.
3
Immunophenotyping Mouse Spleen and Kidney Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mouse spleens were firstly weighed, photographed, and then processed into single cell suspension through grinding gently. Trimmed of extra fat, kidneys were carefully minced and digested in 1640-RPMI (Gibco, Grand Island, NY) containing 10% fetal calf serum (FBS) (Gibco, Grand Island, NY) and 1 mg/mL collagenase I (Gibco, Grand Island, NY) for about 1 h at 37°C. Red blood cells (RBCs) were eliminated by lysis solution (Sigma-Aldrich, St. Louis, Missouri). Dead cells were identified using a fixable viability dyeing (Biolegend, San Diego, CA). An anti-CD16/32 blocking antibody (Biolegend, San Diego, CA) was used to reduce non-specific binding before staining with other antibodies including anti-mouse CD45 (I3/2.3), CD3e (145–2C11), CD19 (6D5), CD4 (GK1.5), CD8a (53–6.7), CD138 (281–2), F4/80 (BM8), CD11b (M1/70), CD11c (N418), MHC-II (25-9-17), CD86 (GL-1), CD40 (3/23), CD80 (16–10A1) and their isotype controls (all from Biolegend, San Diego, CA, USA). Precision count beads (Biolegend, San Diego, CA) were utilized to obtain actual cell numbers, in accordance with the manufacturer’s instructions. Stained cell suspensions were all analyzed by flow cytometry (BD LSR II, Franklin Lakes, New Jersey).
4
Generation of Ndufs3 Knockout B16-F10 Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 system was used to introduce a frameshift mutation in Ndufs3 gene in B16-F10 murine melanoma cell line. In detail, Cas9 protein (Invitrogen #A36497) was transfected following manufacturer’s instructions using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen #CMAX00015) together with synthetic RNA guides designed by Deskgen and purchased from Synthego. Exon 3 targeting guide TTGTGGGTCACATCACTCCG with PAM sequence GGG was used. Cells were split 48 hours after transfection and DNA was extracted using Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich #G1N350). Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451). In particular, 61°C annealing temperature was used for the PCR reaction, with primers forward CTGTAACTCCAGTCTCAGGGA and reverse CACACTGCAGGGATCACTTG. Manual clonal selection was performed in order to identify the cells with frameshift Ndufs3 mutations, leading to the generation of a pool of clones carrying the homozygous c.148A>G and c.150_151insCT mutations. DNA extraction from 96-well plates was performed using 8 μL of Lysis Solution (Sigma-Aldrich #L3289) and 80 μL of Neutralization Buffer (Sigma-Aldrich #N9784) per sample, following manufacturer’s instructions.
5
Investigating Inflammatory Responses in PHM1-41 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PHM1-41 cells were seeded at a density of 40,000 cells/well into 24-well plates in DMEM supplemented with 10% FCS and 2 mM L-glutamine (G-418 omitted as per ATCC recommendation). Cells were incubated overnight at 37 °C (5% CO2, 20% O2) to adhere to the plate. Cells were then serum-starved by replacement of media with DMEM supplemented with 1% TSL and 2 mM L-glutamine and incubated for a further 16 h. Following serum-starving, cells were pre-treated with either TNF (0.1 ng/ml), LPS (100 ng/ml) or vehicle control in a low-serum media (DMEM supplemented with 2% FCS and 2 mM L-glutamine) for two hours. Subsequently, this pre-treatment was removed and replaced with treatments of TNF or LPS, with or without nifedipine (10 µM) and incubated for another 24 h. At completion, cells were washed with PBS and frozen at − 80 °C with lysis solution (Sigma-Aldrich) in preparation for RNA extraction.
6
RNA Isolation and Reverse Transcription Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell isolates were plated for confluence in 12-well dishes (growth area = 380 mm2; Costar, Corning, NY), held in fresh modified MCDB-131 medium with 10% FBS at 37 °C and 5% CO2 in air for 24 h, and subsequently lysed with Lysis Solution supplemented with beta-mercaptoethanol (Merck-Sigma Aldrich) and stored at -80 °C. RNA was extracted using the GenElute Mammalian Total RNA Miniprep Kit (Merck-Sigma Aldrich) or TRIzol Reagent (Thermo Fisher Scientific-Ambion, Carlsbad, CA), following the manufacturer’s guidelines.
Reverse transcription was performed using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad, Hercules, CA), with 100 or 200 ng of RNA input yielding 20 μL of cDNA per reaction. Duplicate reactions were pooled for each sample, and diluted up to 1 in 10 with nuclease-free water for the polymerase chain reaction (PCR).
Reverse transcription was performed using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad, Hercules, CA), with 100 or 200 ng of RNA input yielding 20 μL of cDNA per reaction. Duplicate reactions were pooled for each sample, and diluted up to 1 in 10 with nuclease-free water for the polymerase chain reaction (PCR).
7
Cytokine Profiling of Membrane Biopsies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Membrane biopsies were punched out using an 8 mm biopsy punch (kai Europe GmbH, Solingen, Germany) and were homogenized in 1 ml lysis solution (Sigma, Taufkirchen, Germany). Lysates were centrifuged at 10000×g at 4 °C for 10 min and stored at − 70 °C. Quantification protein content was performed using Pierce BCA protein assay kit (Thermo Fisher Scientific) according to the manufacturer’s instruction and by a plate-reader (MRX Revelation, Dynex Technologies, Denkendorf, Germany).
Lysates were analyzed using the chemiluminescence-based Proteome Profiler Array Human XL Cytokine Array Kit (Bio-Techne GmbH) according to manufacturer’s instruction. Chemiluminescence images (Fig.1 ) were taken by a CCD-Imager (Amersham Imager 600 RGB, GEHealthcare Life Sciences). The obtained dot signals (gray values) were quantified using ImageQuant TL 8.1 software (GEHealthcare Life Sciences). The calculated values obtained from individual lysates were adjusted according to protein content. In addition, single factors within membrane lysates were analyzed by ELISA (TECOmedical, see above).
Lysates were analyzed using the chemiluminescence-based Proteome Profiler Array Human XL Cytokine Array Kit (Bio-Techne GmbH) according to manufacturer’s instruction. Chemiluminescence images (Fig.
8
Western Blot Analysis of pSTAT-3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Noradrenergic nuclei from the brainstem were homogenized in lysis solution (Sigma Aldrich, St. Louis, MO) and protein concentrations were determined using a micro BCA assay (Pierce, Rockford, IL). Equal quantities of protein (20 µg) were loaded on to SDS-PAGE gels (NuPAGE, Invitrogen, Carlsbad, CA) and separated. Gels were blotted onto nitrocellulose membranes and the membranes were probed with pSTAT-3 antibody (1:1000; goat-polyclonal; Santa Cruz Biotechnology, Dallas, TX) and GAPDH antibody (1:2000; mouse-monoclonal; Sigma-Aldrich, St. Louis, MO). After washing, the membranes were incubated in blocking solution containing goat anti-rabbit DyLight 800 and goat anti-mouse DyLight 680 secondary antibodies (1:5000; Thermo Fisher Scientific; Waltham, MA). Bands were visualized using an Odyssey imaging system (Li-COR biosciences, Lincoln, NE).
9
MTT-Based Cell Viability Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (10,000) were plated in 6-well dishes in F12 medium or RPMI medium. Five days after transfection or 5-FU treatment, 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and sodium succinate (both from Sigma-Aldrich, Madrid, Spain) were added to the culture medium (final concentration 0.63 mM and 100 μM, respectively) and incubated for 2.5 h at 37 °C. Then, the culture medium was removed and the lysis solution (0.57% of acetic acid and 10% of SDS in DMSO) (Sigma-Aldrich, Madrid, Spain) was added. Absorbance was measured at 570 nm in a Modulus Microplate spectrophotometer (Turner BioSystems, Madrid, Spain). Cell viability results were expressed as the percentage of cell survival relative to the controls.
10
Cytotoxicity Evaluation of AuNP Formulations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The in vitro cytotoxicity was determined by means of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method. In brief, HaCaT, 1BR3, A375 and B164A5 cells were seeded in 96-well plates at an initial density of 1 × 104 cells/well and allowed to attach. Next, the old medium was removed and a fresh one was added containing AuNP formulations in dimethyl sulfoxide – DMSO (AuNP, AuNP + Bet, AuNP Peg, and AuNP Peg + Bet) at the final concentration of 10 and 50 μM equivalent of betulin, and the cells were incubated for 24, 48, and 72 h. The control cells were treated with the same amount of DMSO, the highest concentration of DMSO present in the medium being 0.5%. A volume of 10 μL MTT reagent (5 mg/mL) was added in each well. During a 4 h contact period, the intact mitochondrial reductase converted and precipitated MTT as blue crystals. The precipitated crystals were dissolved in 100 μL of lysis solution provided by the manufacturer (Sigma-Aldrich). Finally, the reduced MTT was spectrophotometrically analyzed at 570 nm, using a microplate reader (xMark Microplate Spectrophotometer, Bio-Rad). The in vitro experiments were carried out in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!