Universal rt pcr kit

The mRNA expression of STAT1 and STAT3 genes in cardiomyocytes was detected. Cells were collected and total RNA was extracted with TRIZOL. The extracted RNA samples were dissolved in water without RNase contamination. The absorbance values at 260/280 nm were determined using a universal RT-PCR kit (Solarbio, Beijing). The upstream primer sequence of the STAT1 gene was 5′ ATTATTGACGGGTTGTTTATGG 3′, the downstream primer sequence was 5′ GGTGCCTGTAGT CCTGGATG 3′, and the amplified product was 430 bp. The upstream primer sequence of the STAT3 gene was 5′CTGGCCGGAACAAGAGTG3′, the downstream primer sequence was 5′ GTGGATGCAAGGGTGGTG 3′, and the amplified product was 373 bp. The upstream primers of β-actin were 5′ CTGAGAGGGAAATCGTGCGT 3′ and the downstream primers were 5′TGGAAGGTGGACAGTGAGGC3′, and the amplified product was 448 bp. The amplified products were separated by electrophoresis with 2% agarose and then photographed by a UVP imaging analysis system. Quantity One software was used for grayscale analysis. Each experiment was repeated 5 times, and the grayscale ratio between target gene bands and β-actin was calculated.

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The RNA concentration was measured by absorbance of ultraviolet light at a wavelength of 260/280 nm, using the BioPhotometer (Hamburg, Germany). We performed reverse transcription using Universal RT-PCR Kit (Solarbio, Beijing, China) to obtain cDNA templates. qPCR was performed using SYBR Green Fast qPCR Mix (ABclonal, Beijing, China), according to the manufacturer's instructions. qPCR was conducted using SYBR solution (5 ul), primer (0.6 ul), and template DNA (4.4 µl). The reaction conditions for qPCR were 95°C for 5 min, followed by 40 cycles of 95°C for 10 sec, 60˚C for 30 sec, and 68°C for 50 sec. Primers for AQP9 and β-actin were obtained from Sangon Biotech (Shanghai, China). β-Actin was used as an internal control. Primer sequences for the analyzed genes are shown in Table 1.

mRNA was extracted from the lung tissue using a universal RT-PCR Kit (Solarbio Science & Technology Co., Ltd., Shanghai, China) following the manufacturer’s instructions. Samples were treated with DNase and then purified using an RNeasy kit (Qiagen, Hilden, Germany). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as internal reference. PCR primer sequences included the following: ACBD5: forward primer: 5’-TCGCAGGCGAAATTATCTTTG-3’; reverse primer: 5’-GTGCCAACCACTGAGCAATAA-3’, S100A9: forward primer: 5’-CATAAATGACATCATGGAGGACC-3’; reverse primer: 5’-TTGCCATCAGCATCATACACTC-3’, CD46: forward primer: 5’-TGGAAGGCAGTAGCATGGTGAT-3’; reverse primer: 5’-GAGGCTTGGTAGGATGAGTAGGC-3’, MAP2K7: forward primer: 5’-CAATGACTTGGAGAACTTGGGTG-3’; reverse primer: 5’-CGCCGCATTTGCTTAACAG-3’, PTK6: forward primer: 5’-CTGCGTGACTCTGATGAGAAAGC-3’; reverse primer: 5’-AGGTCACGGTGGATGTAATTCTG-3’, GAPDH: forward primer: 5’-CCTCGTCCCGTAGACAAAATG-3’; reverse primer: 5’-TGAGGTCAATGAAGGGGTCGT-3’.

mRNA was extracted from the superficial dorsal horn using a universal RT-PCR Kit (Solarbio Science & Technology Co., Ltd., Shanghai, China) following the manufacturer's instructions. Samples were treated with DNase and then purified using an RNeasy kit (Qiagen, Hilden, Germany). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as internal reference. PCR primer sequences included the following: IL-6: forward primer: 5′-ATGAAGTTTCTCTCCGCAAGAGACTTCCAGCCAG-3′; reverse primer: 5′-CTAGGTTTGCCGAGTAGACCTCATAGTGACC-3′, TNF-α: forward primer: 5′-CTCCCAGAAAAGCAAGCAAC-3′; reverse primer: 5′-CGAGCAGGAATGAGAAGAGG-3′, IL-1β: forward primer: 5′-ATGCCTCGTGCTGTCTGAC-3′; reverse primer: 5′-TCCCGACCATTGCTGTTTCC-3′, VEGF: forward primer: 5′-GGCTCTGAAACCATGAACTTTCT-3′; reverse primer: 5′-GCAGTAGCTGCGCTGGTAGAC-3′, NF-κB p65: forward primer: 5′-GACGAGGCTCGGAGAGCCCA-3′; reverse primer: 5′-CTGGGGCGGCTGACCGAATG-3′, PI3K: forward primer: 5′-TGCTATGCCTGCTCTGTAGTGGT-3′; reverse primer: 5′-GTGTGACATTGAGGGAGTCGTTG-3′, AKT: forward primer: 5′-GTGCTGGAGGACAATGACTACGG-3′; reverse primer: 5′-AGCAGCCCTGAAAGCAAGGA-3′, GAPDH: forward primer: 5′-TGATGACATCAAGAAGGTGGTGAAG-3′; reverse primer: 5′-TCCTTGGAGGCCATGTGGGCCAT-3′.

Total RNA was extracted from rat kidneys using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA), and RNA quantities were determined using a NanoDrop ND-2000 spectrophotometer (NanoDrop Technologies, Wilmington, NC, USA). The cDNA was synthesized using the Universal RT-PCR Kit (Solarbio, Beijing, China).
Quantitative PCR using SYBR Green was used to determine gene expression (qPCR). Quantitative polymerase chain reaction (qPCR) using a 2X SYBR Green PCR Matrix was performed on a 7300 Applied Biosystems Step One PlusReal-Time PCR System (Thermo Fisher Scientific) (Solarbio, China). The PCR cycling conditions were as follows: initial denaturation at 95 °C for 2 min, followed by 30 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 1 min, and extension at 72 °C for 15 s. To normalize expression, the housekeeping gene β-actin was employed as a control. The relative quantification (RQ) formula was used to calculate gene expression levels. The target gene cycle threshold (Ct) value was normalized to β-actin’s Ct value in the same sample, and the relative expression was calculated using the 2^−ΔΔCt method [40 (link)].

mRNA was extracted from the lung tissue with a universal RT-PCR Kit (Solarbio Science and Technology Co., Ltd., Shanghai, China) by following the manufacturer's instructions. Samples were treated with DNase and then purified by using an RNeasy kit (Qiagen, Hilden, Germany). Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as the internal reference. The PCR primer sequences included the following: Muc5b: forward primer: 5′-CCACCTACGAGGACTTCAACAT−3′; reverse primer: 5′-TTACCAGGACAGAGCCATTAGAC−3′, Mmp-7: forward primer: 5′-GGCATTCCAGAACTGTCACCTA−3′; reverse primer: 5′-CTTGCGAAGCCAATTATGATGT−3′, Mmp-10: forward primer: 5′-CCACTCAACCATGGATCTTGC−3′; reverse primer: 5′-ACAGTGTTCGAGTCCAGCTTCC−3′, Mmp-13: forward primer: 5′-GCCACCTTCTTCTTGTTGAGTTG−3′; reverse primer: 5′-GACTTCTTCAGGATTCCCGCA−3′, Abca3: forward primer: 5′-GGAGCTGGCTACCACATGACAC−3′; reverse primer: 5′-GGGAAGAATAAAGGACAACTCGG−3′, Cyp24a1: forward primer: 5′-CCTTCGCTCATCTCCCATTC−3′; reverse primer: 5′-ATTATCCAGCAGAGAGCCAGGTG−3′, Gapdh: forward primer: 5′-CTGGAGAAACCTGCCAAGTATG−3′; reverse primer: 5′-GGTGGAAGAATGGGAGTTGCT−3′.

Total RNAs were obtained via Triquick reagent (R1100; Solarbio, China), whose quantities and purities were detected utilizing NanoDrop Lite UV-Vis Spectrophotometer (ND-LITE; Thermo Fisher Scientific). Then, the RNAs were reversely transcribed into cDNA using the cDNA synthesis kit (11117831001; Roche, Switzerland). Thereafter, qRT-PCR amplification was carried out in ABI7500 instrument (Applied Biosystems, USA) with the help of universal RT-PCR kit (RP1100; Solarbio). The levels of ESM1, proliferating cell nuclear antigen (PCNA), E-cadherin, N-cadherin, and Vimentin were normalized to that of GAPDH. Primer sequences were listed as below (5′–3′). ESM1: TGGTGAAGAGTTTGGTATCTGC, TTTTCCCGTCCCCCTGTCA; SPI1: GTGCCCTATGACACGGATCTA, AGTCCCAGTAATGGTCGCTAT; PCNA: CCTGCTGGGATATTAGCTCCA, CAGCGGTAGGTGTCGAAGC; E-cadherin: CGAGAGCTACACGTTCACGG, GGGTGTCGAGGGAAAAATAGG; N-cadherin: TCAGGCGTCTGTAGAGGCTT, ATGCACATCCTTCGATAAGACTG; Vimentin: GACGCCATCAACACCGAGTT, CTTTGTCGTTGGTTAGCTGGT; and GAPDH: GGAGCGAGATCCCTCCAAAAT, GGCTGTTGTCATACTTCTCATGG.