Dnaman software

The cDNA sequence of BtabIPPI was identified using TBLASTN from the genome database of B. tabaci. The amino acid sequences of IPPI proteins from other insect species were retrieved from the National Center for Biotechnology Information (NCBI). Multiple sequence and identity analyses were carried out using the DNAMAN software (version 5.0; LynnonBioSoft, Quebec, QC, Canada). The theoretical molecular weights (MW) and isoelectric points (pI) of BtabIPPI were calculated using the ExPASy web tool (http://ca.expasy.org/tools/pi_tool.html). Exon–intron structure analysis was deduced using GSDS (http://gsds.cbi.pku.edu.cn/). The conserved structural domains of BtabIPPI were predicted in the Simple Module Architecture Research Tool (SMART) (http://www.smart.embl-heidelberg.de/) and the Conserved Domains Database (CDD) (http://www.ncbi.nlm.nih.gov/cdd/). Signal peptides were predicted using the Signal P 5.0 server (http://www.cbs.dtu.dk/services/SignalP/). Finally, a phylogenetic tree was constructed by the neighbor-joining method in the MEGA 5.0 software package, and bootstrap analysis was performed with 1,000 replications.

To screen the cDNA encoding the precursor of bdellin-HM, the synthesized cDNA was used as the template for PCR. Two pairs of oligonucleotide primers (Table 1) were used in PCR reactions, where primers 1 and 3 were designed according to the partial N-terminal sequence of bdellin-HM determined by Edman degradation and primers 2 and 4 are from the SMART™ (Clontech, Palo Alto, CA, USA) PCR cDNA Construction kit. The PCR conditions were 5 min at 95 °C, and then running 30 cycles with a temperature of 30 s at 95 °C, 30 s at 60 °C, and 60 s at 72 °C, finally holding at 72 °C for 10 min. The final PCR products were cloned into pGEM^®-T Easy vector (Promega, Madison, WI, USA). An Applied Biosystems DNA sequencer (Model ABI PRISM 377, Shimadzu Corporation, Kyoto, Japan) was used for DNA sequencing. Subsequently, the blast search (NCBI) was performed for sequence alignment with other previously reported peptides. Multiple sequence alignments were performed by DNAman software (Lynnon Biosoft, Quebec, QC, Canada). The phylogenetic tree was constructed by using MEGA 5.1 (Tokyo Metropolitan University, Tokyo, Japan) with the neighbor-joining (NJ) method.

The sequenced Ganoderma lucidum ITS sequences derived from this study (GenBank accession nos: KX589244-KX589250) were annotated based on Profile Hidden Markov Models (HMMs) [42 (link)]. The ITS1 and ITS2 regions from the ITS sequences were annotated and extracted using the HMMER suite [43 (link)] (version 3.1b) and the ITSx package [44 ] (version 1.0.11). The ITS1 annotated sequences were then reevaluated by NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The ITS2 annotated sequences were then reevaluated by ITS2 database (http://its2.bioapps.biozentrum.uni-wuerzburg.de/) [45 (link)]. A set of 378 unique Ganoderma lucidum rDNA-ITS sequences was retrieved from the GenBank NT (Nucleotide) database, including 52 individual ITS1 sequences and 50 individual ITS2 sequences. All of the downloaded sequences were annotated following the above procedure. The sequenced and annotated ITS1 and ITS2 sequences of Ganoderma lucidum were combined separately for further analyses. Multiple sequence alignments of annotated ITS1 sequences of seven spawn Ganoderma lucidum strains were performed using DNAMAN software (version 6.0; Lynnon BioSoft, Canada).

A 627 bp cDNA sequence of CP12 (FE192311.1) was recovered from the SSH cDNA library of S. guianensis. It contained the stop codon but lack a 45 bp fragment at the 5′-end. It is mostly homologous to pea CP12 (CAA96570). For amplification of the remaining coding sequence of SgCP12, therefore, a forward primer ZG1129 (CAGAGGAAAAATGGCGACC) was designed based on the sequence of pea CP12, while the reverse primer ZG1130 (CTGATTATGAGGGCGGTTACA) was designed based on S. guianensis CP12 cDNA (FE192311.1). PCR reaction mixture contained primers ZG1129 and ZG1130, the first-strand cDNA as the template, and KOD-Plus DNA polymerase (TOYOBO, Osaka, Japan). DNAMAN software (Lynnon Biosoft, Vaudreuil, Quebec, CA, Canada) was used for analysis of the deduced amino acid sequence of SgCP12.

Reference sequence was selected from Genbank program on NCBI (https://www.ncbi.nlm.nih.gov/). Sequence data were edited by Chromas Application Ver.1.0.0.1. Multiple sequences alignments were performed with SeqMan program of DNASTAR software to identify SNPs. The coding DNA sequences of different exonic regions were conceptually translated to amino acid sequences using DNAMAN software (Lynnon Biosoft, San Ramon, CA, USA).

A total of 106 positive PCR products obtained after ompB, ompA, and gltA PCRs were randomly selected and purified using the GF-1 Ambi Clean kit (Vivantis, USA), according to the manufacturer's instructions. Purified DNA amplicons were sequenced in both directions, using the same primers as for the single gltA PCR and the second PCR of each nested PCR amplification targeting ompA and ompB genes. The Big Dye Terminator cycle sequencing ready reaction kit (Applied Biosystems, Foster City, USA) and an ABI3730XL automated DNA sequencer (Macrogen Europe, Amsterdam, The Netherlands) were employed.
The chromatograms were evaluated with Chromas Lite v 2.01 (http://www.technelysium.com.au/chromas_lite.html). To obtain maximal data accuracy, sequences were determined on both forward and reverse strands. Indeed, the complementary strands of each sequenced product were manually assembled by using the DNAMAN software (Version 5.2.2; Lynnon Biosoft, Que., Canada). The primer region sequences were automatically removed and the overlapping parts were selected.