Polyethyleneimine solution

The reagents that were used in the experiments are listed below. (1) Sigma-Aldrich, Saint Louis, MO, USA: Poly(ethyleneimine) solution (Cat. no. P3143), penicillin–streptomycin (Cat. no. P4333), L-Glutamine (Cat. No G85402). (2) Life Technologies, Grand Island, NY, USA: B-27 supplement (Cat. no. 17504044), Trypsin 2.5% (Cat. no. 15090046). (3) Molecular Probes, Eugene, OR, USA: Fura-2 AM (Cat. no. F1221). (4) Tocris Bioscience, Bristol, UK: UBP 310 (Cat. no. 3621), 5-Nonyloxytryptamine oxalate (Cat. No. 0901), WIN 55,212-2 mesylate (Cat. no. 1038) (5) Alomone Labs, Jerusalem, Israel: D-AP5 (Cat. no. D-145), NBQX (Cat. no. N-185). (6) Cayman Chemical, Ann Arbor, MI, USA: Bicuculline (Cat. no. 11727), HEMADO (Cat. No. 21015); (7) AppliChem, Darmstadt, Germany: EDTA (Cat. no. A5097), EGTA (Cat. no. A-0878). (8) Dia-M, Moscow, Russian Federation: HEPES (Cat. no. 3350). (9) Abcam, Cambridge, UK: N6-Cyclohexyladenosine (Cat. no. ab120472). (10) Paneco, Moscow, Russian Federation: Neurobasal-A medium.

A375 cells growing in a 35-mm plate were transfected after reaching 80% of the confluence with a mixture of two plasmids used in the CRISPR/Cas9(D10A) system. The double Nickase Plasmid system from Santa Cruz Biotechnology Inc. (Heidelberg, Germany) comprises coding sequences for nickase Cas9 (D10A), two different guideRNA (gRNA) sequences designed specifically for the gelsolin gene (sc-401005-NIC), and two cell selection methods, i.e., puromycin resistance and green fluorescent protein (GFP). The gRNAs’ sequences for GSN are as follows: 5′ccgggccgtgcagcaccgtg3′ and 5′atccagctgcacggtaaaga3′. For cell transfection, 2 mg/mL polyethyleneimine solution (Sigma-Aldrich, Poznań, Poland) was used in a ratio of 1:2.175 for 4 µg of DNA solution. Then, 24 h after transfection, the cells were seeded onto 15 cm plates. Cells were incubated with puromycin (Santa Cruz Biotechnology Inc., Heidelberg, Germany) at a concentration of 1 µg/mL. After forming the clones, they were then transferred individually using glass cylinders into a 24-well plate. The clones’ cultivation was continued with the usage of a selective antibiotic at a concentration of 0.5 µg/mL. After the stable lines were derived, they were verified for their correctness using immunocytochemistry, Western blot, and gDNA analyses to confirm the deprivation of GSN.

Tetraethyl orthosilicate (TEOS, 98%), cetyltrimethylammonium chloride solution (CTAC, 25% in H₂O), triethanolamine (TEA, 99%), hydrochloric acid (HCl, 1 N), rhodamine B basic violet 10 (RhodB, 93%), fluorescein 5(6)-isothiocyanate (FITC, ≥90% HPLC), polyethyleneimine solution (PEI, 50% w/v in H₂O), N-(3-dimethylaminopropyl)-N′-ethyl-carbodiimide (EDC, 97%), N-hydroxysulfosuccinimide sodium salt (sulfo-NHS, ≥98% HPLC), doxorubicin hydrochloride (Dox, suitable for fluorescence, 98–102%, HPLC), sodium acetate buffer solution, MES hydrate (titration, ≥99.5%), hyaluronidase type I-S (Hyal-1, from bovine testes), hyaluronidase Type II (Hyal-2, from sheep testes) were purchased from Sigma Aldrich. Sodium hyaluronate (HA, research grade, 289 kDa) was obtained from LifeCore BioMedical. Dulbecco’s modified eagle medium (DMEM), and Lysotracker RED DND-99 were purchased from Molecular Probes. Gentamicin, Dulbecco’s phosphate buffered saline (PBS, no calcium, no magnesium), Hank’s balanced salt solution (HBSS, no phenol red), GlutaMaxi supplement, fetal bovine serum (FBS, South America origin), Ethanol (absolute, 99.9%), Vybrant DiO cell-labeling solution were purchased from ThermoFisher Scientific. Trypan blue solution (0.4%, TC grade) was purchased from Life Science. All the chemicals were used without further purifications.

Primary hippocampal cells were obtained from murine embryos (day 18 of gestation). A detailed protocol for culture preparation is described in Vedunova et al., 2015 (link). Hippocampi were surgically isolated. Cell dissociation was achieved through mechanical dissection followed by incubation for 20 min in 0.25% trypsin-EDTA solution (Gibco, 25200056, United States). The obtained cell suspension was centrifuged at 1000 rpm for 3 min. Then, the cell pellet was resuspended in Neurobasal^TM medium (Gibco, 21103049, United States) supplemented with 2% B27 (Gibco, 175040446, United States), 0.5 mM L-glutamine (Gibco, 25030024, United States) and 5% fetal bovine serum (FBS) (PanEco, K055, Russia). To perform a viability assessment, immunocytochemical analysis and registration of functional calcium activity, we placed cells on coverslips (18x18 mm) pretreated with polyethyleneimine solution (1 mg/mL) (Sigma-Aldrich, Germany). For electrophysiological experiments, cells were cultured on multielectrode arrays (MEAs; MEA60, Multichannel, Germany). The initial density of cells was 9000 cells/mm². Half of the medium containing 0.4% FBS was replaced every third day. Cell viability was maintained under constant conditions of 35.5°C, 5% CO₂ and a humidified atmosphere in a CO₂ incubator (Sheldon Manufacturing, United States).