Log In Sign up
The largest database of trusted experimental protocols

Egfp lc3

Manufactured by Addgene
Visit Supplier
Sourced in United States

EGFP-LC3 is a plasmid that expresses enhanced green fluorescent protein (EGFP) fused to the microtubule-associated protein 1 light chain 3 (LC3) protein. LC3 is a marker for autophagosomes, which are double-membrane vesicles involved in the autophagy process. The EGFP-LC3 construct allows for the visualization and tracking of autophagosomes in live cells.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions) Gfp rab7, by Addgene (3 mentions) Tf lc3, by Addgene (2 mentions) Mkeima red mito 7, by Addgene (2 mentions) Lipofectamine ltx transfection reagent, by Thermo Fisher Scientific (2 mentions) Mito gcamp5g, by Addgene (2 mentions) Percivalhr, by Addgene (2 mentions) Pcdna3.1 vector, by Thermo Fisher Scientific (2 mentions) Tcs sp5 instrument, by Leica (2 mentions) Ptflc3, by Addgene (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Mitogfp, by Addgene (1 mentions) Ha nedd4, by Addgene (1 mentions) Heparin, by Merck Group (1 mentions) Rpmi 1640 media, by Corning (1 mentions) Epidermal growth factor (egf), by Merck Group (1 mentions) Fibroblast growth factor (fgf), by R&D Systems (1 mentions) Dmem f12 50 50 medium, by Corning (1 mentions) L glutamine, by Thermo Fisher Scientific (1 mentions) Pbabe puro mcherry egfp lc3, by Addgene (1 mentions)

Spelling variants of this product

EGFP-LC3 plasmid (10 citations) MRFP-EGFP-LC3 (3 citations) PBABEpuro-EGFP-LC3 (3 citations) PmRFP-EGFP-LC3 plasmid (3 citations) PGK EGFP-LC3 (2 citations) PmRFP-EGFP-LC3 (21074), (2 citations) PmRFP-EGFP-LC3 (2 citations) MCherry-EGFP-LC3 (2 citations) PBabe-puro-mCherry-EGFP-LC3 (2 citations)

21 protocols using egfp lc3

1

Generation of AAV2 Vectors with Fluorescent Reporters

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
AAV2-GFP-P2A-mitoDsRed was generated by subcloning the mitoDsRed from the original adenovirus vector (Nasr et al., 2008 (link)) into MluI and XhoI sites downstream of the P2A of pAM-CBA-eGFP-P2A. To generate AAV2-eGFPLC3-P2A-mitoDsRed the GFP coding region was removed from AAV2-GFP-P2A-mitoDsRed plasmid and replaced with eGFPLC3 (Addgene: #22405). Purified AAV plasmid was packaged using the helper-free method as reported previously (Ayuso et al., 2010 (link); Liu et al., 2014 (link)). In brief, HEK293T cells at 70–80% confluency were transfected with two packaging plasmids, one carrying AAV rep and cap, the other with AAV helper functions, and the transgene using a polyethylenimine method (PEI; polyethylenimine, linear, MW 25k, Warrington, PA). Three days post transfection, cell supernatant, and lysates were harvested. 40% PEG 8000 was added to precipitate crude virus for 2 h. AAV samples were double-ultracentrifuged in a cesium chloride gradient with isolated viral fractions dialyzed in 0.1 M PBS/0.5% Sorbital overnight (Ayuso et al., 2010 (link); Liu et al., 2014 (link)). Purified fractions were added to HEK293T cells to verify function. Quantitative real-time PCR of purified viral fractions was done to determine viral titer. The viral titer of AAV2 was 1.2 × 1013 GC/ml.
Kedra J., Lin S., Pacheco A., Gallo G, & Smith G.M. (2021). Axotomy Induces Drp1-Dependent Fragmentation of Axonal Mitochondria. Frontiers in Molecular Neuroscience, 14, 668670.
+ Open protocol
+ Expand
2

Mitochondrial Dynamics Imaging Constructs

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
AAV2/1.CMV.PI.Cre.RBG was purchased from Penn Vector Core (Philadelphia, PA). Drp1 shRNA-smCBA-mTagBFP2 was cloned into the pTR-CBA eGFP vector to replace eGFP [Drp1-targeting shRNA was a gift of S. Strack, University of Iowa (73 (link))]. The following constructs were previously cloned into the pCAGGS vector downstream of the chicken actin promoter: ATP-YEMK (gift of H. Noji, Osaka University) (74 (link)), Cre recombinase (2 (link)), EGFP-LC3 (Addgene), mitoGFP (4 (link)), and mitoTagBFP (2 (link)). mitoFarRed was generated by fusing TagRFP657 [gift from V. Verkhusha (Albert Einstein)] to the mitochondria-targeting sequence, cytochrome C oxidase subunit VIII (75 (link), 76 (link)), and mitoKeima was generated by cloning mito-mKeima from pIND-mito-mKeima (gift of A. Miyawaki) into pCAGGs. OM-GFP was made by fusing the OM-targeting sequence of rat Tom20 to GFP (77 (link)). GFP-Parkin was made by fusing GFP to Parkin (gift from A. Abeliovich, Columbia) and Matrix-roGFP from Addgene. pGW1-mitoEOS2 was cloned into the pGW1 from pEOS2-mito.
Li H., Doric Z., Berthet A., Jorgens D.M., Nguyen M.K., Hsieh I., Margulis J., Fang R., Debnath J., Sesaki H., Finkbeiner S., Huang E, & Nakamura K. (2021). Longitudinal tracking of neuronal mitochondria delineates PINK1/Parkin-dependent mechanisms of mitochondrial recycling and degradation. Science Advances, 7(32), eabf6580.
+ Open protocol
+ Expand
3

Plasmid Construction for αSyn Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols
Construction of pcDNA3.1 vector used to express human wild-type, A30P, A53T, E46K, or Δ71–82 αSyn (GenBank L08850) was as previously described [38 (link)–40 (link)]. The αSyn K80R mutant was generated by site-directed mutagenesis using wild-type αSyn. Human wild-type RER1 construct with or without myc tag was previously described [19 (link)]. RER1Δ25 construct was generated by PCR using pAG3zeo wild-type RER1. The constructs of HA-NEDD4 (Plasmid #27002) and EGFP-LC3 (Plasmid #11546) were purchased from Addgene.
Park H.J., Ryu D., Parmar M., Giasson B.I, & McFarland N.R. (2017). The ER retention protein RER1 promotes alpha-synuclein degradation via the proteasome. PLoS ONE, 12(9), e0184262.
+ Open protocol
+ Expand
4

Cell Culture Conditions for Glioblastoma and Lung Cancer

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Human GBM cell lines, U87, U87/EGFRvIII, T98 and U251, were cultured in Dulbecco’s modified Eagle’s media (DMEM) supplemented with 5% FBS (Cytiva HyClone) and 2 mM L-glutamine (Gibco) in a humidified atmosphere of 5% CO2 and 95% air at 37°C. Human lung cancer cell lines, H520 and HCC827, were cultured in RPMI-1640 media (Corning) supplemented with 5% FBS (Cytiva HyClone) and 2 mM L-glutamine (Gibco) in a humidified atmosphere of 5% CO2 and 95% air at 37°C. U87/GFP-LC3, U251/mRFP-GFP-LC3 and U251/RFP-LC3 cells were generated by transfection of EGFP-LC3 (Addgene),58 (link) ptfLC3 (mRFP-GFP-LC3) plasmid (Addgene)59 (link) or pmRFP-LC3 plasmid (Addgene)59 (link) into U87 or U251 cells followed by G418 (200 μg/mL) selection for 14 days to obtain stable clones.59 (link) GBM30 and GBM83, primary GBM patient-derived cells, have been previously described28 (link) and were cultured in DMEM/F12 50/50 medium (Corning) supplemented with B27 (1x) (Gibco), Heparin (2 μg/mL) (Sigma), EGF (20 ng/mL) (Sigma) and FGF (20 ng/mL) (R&D Systems) and 2 mM L-glutamine (Gibco) in a humidified atmosphere of 5% CO2, 95% air at 37°C. When GBM30 cells were used for cholesterol depletion experiments, the cells were placed in 5% FBS/DMEM and 5% LPDS/DMEM culture as U251 cells. The cell lines were tested for mycoplasma contamination routinely.
Britton B.J., Evans J.G, & Potter J.M. (1998). Does the fly matter? The CRACKPOT study in evidence based trout fishing. BMJ : British Medical Journal, 317(7174), 1678-1680.
+ Open protocol
+ Expand
5

Plasmid Acquisition and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following plasmids were obtained from Addgene (Cambridge, MA USA) and directly used in the study: EGFP- microtubule-associated protein light chain 3 (EGFP-LC3) (Plasmid #11546), pBabe-puro-mCherry-EGFP-LC3 (plasmid #22418) and mouse kif5B (pKin1B, plasmid #31604). Kif5B were PCR amplified and subcloned into pEGFP-C1 vector. pcDNA3.1-full length htt23Q (fhtt23Q) and pcDNA3.1-fhtt145Q were originally obtained from HD Community BioRepository Collection. EGFP was engineered to the C-terminus of fhtt23Q (fhtt23Q-EGFP) and fhtt145Q (fhtt145Q-EGFP). Cells were transiently transfected with different plasmids using Lipofectamine 2000 (Invitrogen, Grand Island, NY, USA).
Erie C., Sacino M., Houle L., Lu M, & Wei J. (2015). Altered lysosomal positioning affects lysosomal functions in a cellular model of Huntington's disease. The European journal of neuroscience, 42(3), 1941-1951.
+ Open protocol
+ Expand
6

CRISPR/Cas9 Editing of TRAC Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following expression plasmids were obtained from Addgene: tf-LC3, EGFP-LC3 (#11546), mRFP-LC3 (#21075), GFP-Rab5B (#61802), EGFP-Rab6A (#49469), GFP-Rab7 (#12605), dsRed-Rab7 (#12661), dsRed-Rab11 (12679), LAMP1-RFP (#1817), mCherry-LAMP1 (#45147), mCherry-Atg5 (#13095), mCherry-p62(#55132), EGFP-Vamp7 (#42316), pEGFP-N1, and plasmids for the Sleeping Beauty transposon system, pCMV(CAT)T7-SB100 (#34879) and pSBbiGP (#60511). Plasmids for CRISPR/Cas9-mediated editing of TRAC, including pAP368 (to express TRAC gRNA-1 and EGFP reporter gene), pAP369 (to express TRAC gRNA-2 and EGFP reporter gene), and pAP370 (to express SpCas9) were obtained from Dr. Charles Gersbach’s laboratory. sgRNAs targeting TRAC were purchased from IDT; the sgRNA sequences were: AGAGTCTCTCAGCTGGTACA (sgRNA-1) and TGTGCTAGACATGAGGTCTA (sgRNA-2). PCR primers used in sequencing TRAC were TTGCTGGGGTTTTGAAGAAG (forward) and GGTTTTGGTGGCAATGGATA (reverse).
Mao M., Chang C.C., Pickar-Oliver A., Cervia L.D., Wang L., Ji J., Liton P.B., Gersbach C.A, & Yuan F. (2020). Redirecting Vesicular Transport to Improve Non-viral Delivery of Molecular Cargo. Advanced biosystems, 4(8), e2000059.
+ Open protocol
+ Expand
7

Transfecting RPE cells with EGFP-LC3

Check if the same lab product or an alternative is used in the 5 most similar protocols
RPE cells were transfected with EGFP-LC3 (Addgene, Cambridge, MA; plasmid # 21073) or tfLC3 (Addgene; plasmid #21075) using the Amaxa nucleofector II (Lonza, Rockland, ME). Approximately 1.5 million cells and 5 μg plasmid DNA were used for each transfection. Cells were plated on either serum-coated glass-bottom dishes (MatTek, Ashland, MA) or Transwell filters at confluence.
Toops K.A., Tan L.X., Jiang Z., Radu R.A, & Lakkaraju A. (2015). Cholesterol-mediated activation of acid sphingomyelinase disrupts autophagy in the retinal pigment epithelium. Molecular Biology of the Cell, 26(1), 1-14.
+ Open protocol
+ Expand
8

Fluorescent Markers for Neuronal Organelles

Cited 3 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
GFP-SNPH and GFP SNPH1–469 plasmids were gifts from Sheng laboratory at NIH. For non-GFP SNPH vectors, we cloned SNPH and SNPH1–469 into pcDNA3.1 vectors (Invitrogen) at HindIII and Xho1 restriction sites. We used Addgene plasmids Mito-GCaMP5G (Addgene plasmid #105009; Kwon et al., 2016 (link)), PercivalHR (Addgene plasmid #49082; Tantama et al., 2013 (link)), mKeima-Red-Mito-7 (Addgene plasmid #56018, a gift from Michael Davidson), EGFP-LC3 (Addgene plasmid #11546; Jackson et al., 2005 (link)) and GFP-RAB7 (Addgene plasmid #12605; Choudhury et al., 2002 (link)). pF(UG) hSyn Lamp1-msGFP (#JV012) plasmid was a gift from Jason Vevea/Edwin R. Chapman at UW, Madison. These plasmids were transfected in primary hippocampal neurons on DIV4 using lipofectamine LTX transfection reagent (Thermo Fisher scientific) for 5 hr as described in manufacturer’s protocol.
Joshi D.C., Zhang C.L., Babujee L., Vevea J.D., August B.K., Sheng Z.H., Chapman E.R., Gomez T.M, & Chiu S.Y. (2019). Inappropriate Intrusion of an Axonal Mitochondrial Anchor into Dendrites Causes Neurodegeneration. Cell reports, 29(3), 685-696.e5.
+ Open protocol
+ Expand
9

Transfection of Beclin-1 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
pcDNA3.1 (+)-3× Flag-BECN1 and mutants Flag-BECN1-BD, Flag-BECN1-BD+CCD, Flag-BECN1-BD+CCD+ECD, Flag-BECN1-CCD+ECD, Flag-BECN1-ECD were kindly provided by Dr. Jian-Guo Wu (Wuhan University, China). The PCR products of NP and NSs were both cloned into pVAX1. EGFP-LC3 were purchased from Addgene (11,546; deposited by Karla Kirkegaard). pmCherry-C1-EGFP-LC3B was purchased from Bioworld Technology (PPL00191-2d). Vero cells were grown on confocal dishes to 50% confluent and transfected using Hieff TransTM Liposomal Transfection Reagent (Yeasen, 40802ES02) according to the instructions.
Yan J.M., Zhang W.K., Yan L.N., Jiao Y.J., Zhou C.M, & Yu X.J. (2021). Bunyavirus SFTSV exploits autophagic flux for viral assembly and egress. Autophagy, 18(7), 1599-1612.
+ Open protocol
+ Expand
10

Autophagy Modulation in Breast Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
MDA-MB-231 cells were plated on coverslips and co-transfected with UGDH or negative control siRNA plus two µg of EGFP-LC3 (# 11546, Addgene). 24 h after transfection, tumor cells were treated with 1 µM EPI as described above. After the treatment, the medium was removed, and cells were mounted on glass slides after being washed twice with PBS and fixed in 4% formaldehyde for 30 min. LC3 subcellular localization was analyzed by confocal microscopy using a Leica TCS SP5 instrument (Leica, Milan, Italy). The experiment was also performed treating each well with 20 µM chloroquine (an inhibitor of autophagy). Chloroquine was added to the cells concomitantly with EPI.
Vitale D.L., Caon I., Parnigoni A., Sevic I., Spinelli F.M., Icardi A., Passi A., Vigetti D, & Alaniz L. (2021). Initial Identification of UDP-Glucose Dehydrogenase as a Prognostic Marker in Breast Cancer Patients, Which Facilitates Epirubicin Resistance and Regulates Hyaluronan Synthesis in MDA-MB-231 Cells. Biomolecules, 11(2), 246.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!