A commercial VetMAXTM PEDV/TGEV/PDCoV PCR including primers and probe for Xeno internal positive control (Thermo Fisher Scientific) was included in the present study as a reference PCR (simplified as the reference PCR in this paper). Briefly, 6.50 µL of TaqManTM Fast 1-Step Master Mix (Thermo Fisher Scientific), 0.80 µL of Amplitaq 360 DNA Polymerase (5 U/µL, Thermo Fisher Scientific), 1 µL of VetMAX PEDV/TGEV/PDCoV Primer Probe Mix (Thermo Fisher Scientific), 3.7 µL nuclease-free water, and 8 µL nucleic acid extract were included in a 20 µL reaction. Amplification reactions were performed on an ABI 7500 Fast instrument (Thermo Fisher Scientific) with the following conditions: one cycle of 50 °C for 5 min, one cycle of 95 °C for 10 min, and 40 cycles of 95 °C for 3 s and 60 °C for 30 s. The analysis was undertaken using an automatic baseline, PEDV detector (LIZ equivalent to Cy5) at the threshold of 5%, TGEV detector (FAM) at the threshold of 5%, PDCoV detector (VIC) at the threshold of 5%, and Xeno detector (NED) at the threshold of 10% of the sigmoid amplification curve’s maximum height, respectively. A threshold cycle (Ct) < 36 was considered positive and a Ct ≥ 36 was considered negative for PEDV, TGEV, and PDCoV.
Amplitaq 360 dna polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States
AmpliTaq 360 DNA Polymerase is a thermostable DNA polymerase designed for use in PCR (Polymerase Chain Reaction) applications. It is capable of amplifying a wide range of DNA templates with high efficiency and fidelity.
Automatically generated - may contain errors
Lab products found in correlation
Onestep rt pcr kit, by Qiagen (2 mentions)
Abi 7500 fast instrument, by Thermo Fisher Scientific (1 mentions)
Quantstudio 7 flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
Seqstudio genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Taqman fast virus 1 step master mix, by Thermo Fisher Scientific (1 mentions)
Magmax 96 pathogen rna dna kit, by Thermo Fisher Scientific (1 mentions)
Applied biosystems 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Kingfisher flex purification system, by Thermo Fisher Scientific (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Agilent Technologies (1 mentions)
Mycycler thermal cycler, by Bio-Rad (1 mentions)
Geneamp 2720 thermal cycler, by Thermo Fisher Scientific (1 mentions)
Exosap, by GE Healthcare (1 mentions)
Bigdye terminator version 1.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Geneamp pcr system 9700, by Thermo Fisher Scientific (1 mentions)
Genejet rna purification kit, by Thermo Fisher Scientific (1 mentions)
Gotaq master mix, by Promega (1 mentions)
Rnalater, by Thermo Fisher Scientific (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
11 protocols using amplitaq 360 dna polymerase
1
Multiplex PCR for Detection of Porcine Enteric Viruses
2
Validating Low-quality DNA Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Validation of low-quality DNMs was performed using standard Sanger sequencing approach on an Applied Biosystems SeqStudio Genetic Analyzer (ThermoFisher, MA, USA) to confirm the presence of the mutation in probands and its absence in the parents. Primers for each SNV were designed using PrimerZ63 (link) (Supplementary Data 8 ) and PCR reactions were performed using AmpliTaq 360 DNA Polymerase (ThermoFisher, MA, USA) according to the manufacturer’s protocol.
Validation of CNVs was performed with the whole genome Illumina Infinium CytoSNP-850K v1.1 microarray platform for the larger deletion on chromosome 11 and a gene-specific TaqMan Copy-Number assay designed for NXT2 was exploited to validate the smaller CNV using the Applied Biosystems QuantStudio 7 Flex Real-Time PCR System (ThermoFisher, MA, USA).
Validation of CNVs was performed with the whole genome Illumina Infinium CytoSNP-850K v1.1 microarray platform for the larger deletion on chromosome 11 and a gene-specific TaqMan Copy-Number assay designed for NXT2 was exploited to validate the smaller CNV using the Applied Biosystems QuantStudio 7 Flex Real-Time PCR System (ThermoFisher, MA, USA).
3
Quantification of MHP DNA in Pig Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MHP DNA was tested by Real-Time qPCR testing in individual pig deep tracheal swabs, pen oral fluids, drinker, and air samples. Nucleic acid extraction was done using the MagMAX™-96 Pathogen RNA/DNA kit (Applied Biosystems™, Carlsbad, CA USA) and the Kingfisher™ Flex Purification System (Thermo Fisher Scientific, Inc., Waltham, MA USA). Tracheal swabs, pen-based oral fluids, and drinker samples were tested using TaqMan® Fast Virus 1-Step Master Mix (Life Technologies, Carlsbad, CA) with primers and probes targeting the Mhp183 gene [27 (link)], primers and probes for internal positive control (IPC) [27 (link)], and AmpliTaq® 360DNA Polymerase (5U per µL) (Thermo Fisher Scientific, Inc.). Air samples were tested using TaqMan® Fast Virus 1-Step Master Mix (Life Technologies) with primers and probes targeting the Mhp183 gene [27 (link)] and primers and probes for IPC [27 (link)]. Amplification was done on the Applied Biosystems® 7500 Fast Real-Time PCR System (ThermoFisher Scientific, Inc.). PCR results were considered valid if the IPC cycle threshold (Ct) was < 36 and samples were considered positive for MHP DNA when the Ct < 37.
4
Validation of Whole Genome Sequencing Findings
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bidirectional Sanger sequencing (bSS) was performed (i) to validate WGS results in the PCNSL/SCNSL study cohort if sufficient DNA quantity was available (total: n = 35; PCNSL: n = 26; PCNSL-M: n = 1; SCNSL: n = 2; SCNSL: n = 3; EBV+ : n = 2), and (ii) to identify mutations of recurrently mutated candidates in a larger set of additional PCNSL/SCNSL FFPE samples (FFPE extension cohort). The following genes were analyzed: MYD88, KMT2D (MLL2), HLA-B, SETD1B, HIST1H1E, CD79B, BTG1, MYC, TP53, TERT, GRHPR, TBL1XR1, DST, PRDM15, OBSCN, FAT4, GRP98, and OSBPL10. Briefly, the PCR conditions were: 94 °C for 4 min (1 cycle), followed by 3 cycles of 94 °C for 30 s, 61 °C for 45 s, 72 °C for 60 s, 3 cycles of 94 °C for 30 s, 59 °C for 45 s, 72 °C for 60 s, 3 cycles of 94 °C for 30 s, 57 °C for 45 s, 72 °C for 60 s, 31 cycles of 94 °C for 30 s, 55 °C for 45 s, 72 °C for 60 s, and finally extension at 72 °C for 10 min with AmpliTaq™ 360 DNA Polymerase (Applied Biosystems, Waltham, USA). The PCR primers for the genomic regions of interest are displayed in Supplementary Data 14 . Sequencing was performed at Eurofins Genomics, Ebersberg, Germany. 180/189 (95%) of the selected variants (allele frequency above 10%) identified by WGS were confirmed. The results are displayed in Supplementary Data 4 and 5 .
5
Differential Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complementary DNA was generated with High Capacity RNA-to-cDNA Kit (Applied Biosystems) at 10 ng RNA/μL reverse transcription. Sequences of human and mouse gene primers used are listed in Table S1 and Table S2, respectively. Conventional PCR was performed with MyCycler Thermal cycler (Bio-Rad) following the AmpliTaq® 360 DNA Polymerase protocol (Applied Biosystems). Real-time qPCR reactions were set up in triplicate using SYBR Green PCR Master Mix (Agilent Technologies). All assays used the same PCR conditions. A 2− ΔΔCt experimental design was used for relative quantification and normalized to ACTB (mouse) or GAPDH (human) for differential expression levels of target genes. Nested PCR was conducted for genes with no CT value in real-time qPCR. An additional 40 cycles of PCR were conducted on reverse transcription PCR product using the same gene primers.
6
AFLP Selective Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The selective PCR mix was prepared consisting of 1.2 µl 10× PCR buffer II, 0.72 µl 25 mM MgCl2, 0.24 µl(10 mM) deoxynucleotide triphosphate mix, 0.07 µl Amplitaq 360 DNA polymerase (Applied Biosystems), 0.5 µl of Msel primer (5.0 µM), 0.3 µl EcoRI (1.0 µM) IRD-700 labeled primer (Integrated DNA Technologies, Coralville, IA), 6.97 µl nanopure® water, and 1.5 µl of the preamplification template DNA. This step was performed in the dark due to light sensitivity of the labeled primers. Selective amplification was performed on a GeneAmp 2720 thermal cycler (Applied Biosystems) with one pre-PCR cycle (30 s at 94 °C, 30 s at 65 °C, 1 min at 72 °C), 12 cycles of 30 s at 94 °C, 30 s at 65 °C → 56 °C, 60 s at 72 °C, and 23 cycles of 30 s at 94 °C, 30 s at 65 °C → 56 °C and 60 s at 72 °C. Blue stop solution (LI-COR Biosciences, Lincoln, NE) (2.5 µl) was used to end the reaction. The product was then denatured for 3 min at 94 °C and stored at −20 °C.
7
Grasshopper DNA Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A preamplification mix consisting of 10 µl Preamlification Primer Mix II (LI-COR Biosciences, Lincoln NE, USA), 0.25 µl Amplitaq 360 DNA polymerase, 0.75 µl 25 mM MgCl2, and 1.25 µl 10× PCR buffer II (Applied Biosystems, Foster City, CA) was mixed with 1.25 µl of ligation product and run on a PCR program of 20 cycles (30 s at 94 °C, 1 min at 56 °C, and 1 min at 72 °C), then stored at 4 °C. Nanopure® water was used to dilute the product to a ratio of 1:20. Nucleotide sequences of adapters, preamplification primers and selective primers tested are shown in Table 3 . A combination of different primer sets was tested and the best working primer sets for grasshopper DNA were chosen (Table 4 ).
8
Viral Polymerase Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase gene sequences were obtained by using primers JV12Y-JV13 (18 (link)) or JV12BH-NVp110 (18 (link),19 (link)) in 1 round of amplification. If PCR results were negative, a nested PCR was performed (20 (link)). Using the above-mentioned primers, we performed an RT-PCR with the OneStep RT-PCR Kit (QIAGEN) for the first-round PCR and AmpliTaq 360 DNA Polymerase (Applied Biosystems, Naerum, Denmark) for second-round PCR according to the manufacturers’ instructions. PCR conditions are shown in the online Technical Appendix.
9
AIRE mRNA Transcripts Mapping via Minigene Construct
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A minigene construct, spanning the splice site affected by the mutation c.879+1G>A, and with a total length of 5 exons (exon 5 to exon 10) was designed to map mRNA transcripts of AIRE in PBMCs from patients and healthy individuals. The constructs with their flanking exon-intron boundaries of the AIRE gene were amplified by PCR using AmpliTaq 360 DNA Polymerase (Applied Biosystems) and the following program on a thermal cycler (GeneAmp PCR System 9700, Applied Biosystems): 98°C for 10 minutes, followed by 10 cycles of 98°C for 15 seconds, 69°C for 15 seconds, and 72°C for 1 minute, and 42 cycles of 95°C for 15 seconds, 50°C for 15 seconds, and 72°C 1 minute, followed by 78°C for 1 minute and, finally, 4°C. The PCR product was purified with ExoSap (GE Healthcare) and sequenced using the BigDye Terminator version 1.1 Cycle Sequencing Kit (Applied Biosystems). The primer sequences (5′–3′) were as follows: forward primer, GATTCAGACCATGTCAGCTTC and reverse, GCAGCACGTCCGTACCATCTC (MilliporeSigma), both of which were used for amplification and the sequencing reaction. PCR products were visualized on a simulated gel system following the instructions of the manufacturer (Agilent Technologies).
10
Prepupal Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression patterns of our candidate genes in males and females were examined during the prepupal period using RT-PCR. Head, wings and legs were dissected from St-3 prepupae (prepupae which had just undergone the gut purge, see Gotoh et al. 2011 for a detailed definition of the prepupal stages) of each sex. Dissected tissues were preserved at −20 °C in RNA later (Ambion Inc, Austin, TX) until extraction. RNA was extracted from dissected tissues with the GeneJET RNA purification kit (Thermo Fisher Scientific Inc, Waltham, MA) according to the manufacturer’s protocol. For each sample, 2000 ng of total RNA was reverse transcribed with the iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA). These synthesized cDNAs were used as templates for RT-PCR. See Additional file 2 : Table S1 for primer sequences. The PCR step was performed under the following conditions: 94 °C for 2 min; 37 (for Cmix, CmSxl and Cmtra2) or 40 (Cmdsx) cycles of 94 °C for 30s, 54 °C for 30s and 72 °C for 3 min; and 72 °C for 10 min, using Go Taq Master Mix (Promega, Madison, WI). For Cmtra, the PCR program was: 94 °C for 2 min; 40 cycles of 94 °C for 30s, 54 °C for 30s and 72 °C for 4 min; and 72 °C for 10 min, using AmpliTaq360 DNA polymerase (Applied Biosystems). GAPDH was used as a positive control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!