TRIZOL reagent (Invitrogen) was used to isolate the total RNA of ccRCC tumor samples, and RNA was converted into cDNA with a special cDNA synthesis kit (Promega) according to the manufacturer's protocol. Human gene expression was measured using RT-qPCR on the ABI ViiA™ 7 System (America). Expression of target genes was normalized with the expression of β-ACTIN. The primer sequences were listed in Supplementary Table S1 .
Cdna synthesis kit
Manufactured by Promega
Sourced in United States, China, Germany
The cDNA Synthesis Kit is a complete solution for reverse transcription of RNA to cDNA. The kit provides all the necessary components, including reverse transcriptase enzyme, oligo(dT) primers, and reaction buffers, to efficiently convert RNA into complementary DNA (cDNA) for downstream applications such as PCR, qPCR, or cloning.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (39 mentions)
Rneasy mini kit, by Qiagen (15 mentions)
Trizol, by Thermo Fisher Scientific (14 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (8 mentions)
Master mix pcr amplification reagent, by Promega (7 mentions)
T100 thermocycler, by Bio-Rad (7 mentions)
Abi 7500 fast, by Thermo Fisher Scientific (3 mentions)
Sybr green mix kit, by Thermo Fisher Scientific (3 mentions)
Abi 7300 system, by Thermo Fisher Scientific (3 mentions)
Trizol reagent kit, by Thermo Fisher Scientific (3 mentions)
R taq plus master mix, by Elpis Biotech (3 mentions)
Power sybr green premix, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Dnase, by Thermo Fisher Scientific (3 mentions)
Eco real time pcr system, by Illumina (2 mentions)
Sv total rna isolation system, by Promega (2 mentions)
Abi 7900 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr green qpcr mixes, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Molecular Research Center (2 mentions)
Peqgold trifast, by Avantor (2 mentions)
131 protocols using cdna synthesis kit
1
RT-qPCR Analysis of ccRCC Transcripts
2
Quantitative RT-PCR Analysis of Olfactory Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was obtained using a Trizol prep method and cDNA synthesis was done using DNase I (Thermo Fisher, USA) with a cDNA synthesis kit (Promega, USA) following the manufacturer's method. Real‐time PCR was performed using GoTaq® qPCR Master Mix (Promega, USA) as a CFX96 real‐time system (Bio‐Rad, USA). Real‐time PCR reactions were optimized to 95°C for 2 minutes, 38 amplification cycles at 95°C for 15 seconds, 65°C for 1 minute. Primer sets were designed as follows: OMP, F: 5'‐CGACCTCACCAACCTCATGA‐3', R: 5'‐CATGACCTTGCGGATCTTGG‐3'; GNAL, F: 5'‐GACTACACACCCACAGACCA‐3', R: 5'‐GCCACGTAAATGATCGCAGT‐3'; Olfr1507, F: 5'‐GAAAGCCTTGTCCACCTGTG‐3', R: 5'‐ GGGTTCAGCAGAGGGGTTAT‐3'; Adcy3, F: 5'‐ GGACACGCTCACAAACATC‐3', R: 5'‐ GCCACATTGACCGTATTGC‐3'; β‐actin, F: 5'‐ CATCCGTAAAGACCTCTATGCCAAC‐3', R: 5'‐ATGGAGCCACCGATCCACA‐3'; GAPDH, F:5'‐TGTGTCCGTCGTGGATCTGA‐3', R: 5'‐TTGCTGTTGAAGTCGCAGGAG‐3'. Used as a reference to calculate fold change in target gene expression. The cycle threshold (Ct) values were estimated for the β‐actin and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) as housekeeping gene and target genes.
3
Pili-Stimulated moDC Transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1x105 moDCs were pre-incubated with medium or DC-SIGN specific antibody D1 (10 ug/mL) for 1 hour and thereafter stimulated with 250 pg/mL pili sample B. mRNA was isolated after 6 hours using the lysis buffer from the mRNA Capture kit (Roche). cDNA was made with a cDNA synthesis kit (Promega). Amplification and real-time quantification was performed by PCR with SYBR Green according to manufacturer’s guidelines for the ABI 7500 Fast PCR detection system (Applied biosciences).
4
Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated from the fresh roots as described by SV total RNA isolation system (Promega, USA). The quantified RNA was then converted to cDNA using the cDNA synthesis kit (Promega, USA) before performing real-time PCR analysis in an Eco real-time PCR system (ILLUMINA, UNITED STATES) using gene-specific primers (Supplementary Table S1 ). The PCR reactions were set as follows: 95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, 56 °C for 30 s. The relative expression of candidate genes was calculated considered Actin as an internal control by the dd −∆Ct method31 (link).
5
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from cell lines using TRIZOL reagent (Invitrogen). cDNA was synthesized using a cDNA Synthesis kit (Promega, Madison, WI, USA). Quantitative PCR was performed with 10 ng of cDNA using Power SYBR Green PCR Master Mix (Applied Biosystems), and the cRNA was analyzed with an RT-PCR System kit (StepOne, Applied Biosystems, Darmstadt, Germany); 18S was used as the reference gene for normalization. All values were calculated using the 2−ΔΔCT method.
6
Quantifying RNA Transcript Levels
7
Quantification of Apoptosis-related Genes in Rat Testis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the rat testis tissue samples using TRIzol reagent (Invitrogen; Thermo Fisher Scientific Inc.), and the RNA concentration was measured by spectrophotometry. First-strand cDNA was synthesized using a cDNA synthesis kit (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocol. Subsequently, RT-qPCR was applied to the SYBR-Green mix kit (Applied Biosystems; Thermo Fisher Scientific Inc.). The primers for Hsp70, caspase-3 and caspase-9 were designed as follows: Hsp70 forward, 5′-ATGCTTCAGACCTCCCTT-3′ and reverse, 5′-CTCCACCAACTATCTCCACT-3′; caspase-3 forward, 5′-TGGACTGCGGTATTGAGACA-3′ and reverse, 5′-GCGCAAAGTGACTGGATGAA-3′; caspase-9 forward, 5′-CAAGAAGAGCGGTTCCTGGT-3′ and reverse, 5′-CAGAAACAGCATTGGCGACC-3′; GAPDH was used as a housekeeping gene. The data were measured as a ratio of each mRNA relative to GAPDH mRNA (forward, 5′-ACAGCAACAGGGTGGTGGAC-3′ and reverse, 5′-TTTGAGGGTGCAGCGAACTT-3′). PCR was performed with 40 cycles of 94°C for 30 sec, followed by 56°C for 30 sec and 72°C for 25 sec, using the ABI 7900 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific Inc., Waltham, MA, USA).
8
Hepatic XO Expression Analysis by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hepatic gene expression of XO, the key enzyme for UA formation, was determined by real-time polymerase chain reaction (RT-PCR). Frozen tissues were homogenized and total RNA was extracted using a TRIzol kit (Invitrogen, CA, USA). RNA quality and quantity were assessed by automated capillary gel electrophoresis on a Bioanalyzer 2100 with RNA Nano LabChips (Agilent Technology, Tokyo, Japan). Then, total RNA (1 μg) was reversely transcribed using a cDNA synthesis kit (Promega, CA, USA) with random primers in a 20 μL PCR system according to the manufacturer's protocol. Quantitative PCR was performed by SYBR Green PCR Master Mix (Toyobo, Osaka, Japan) and ABI PRISM 7500 Sequence Detection System (Applied Biosystems Inc., CA, USA). Thermal cycling was carried out at 95°C for 15 min, followed by 40 cycles at 95°C for 15 s, 60°C for 15 s, and 72°C for 32 s. We used 18S rRNA as a housekeeping gene in RT-PCR. The specific primers were selected as follows: XO forward: 5′-GACAGGGTGTTTATGAAGCA-3′, XO reverse: 5′-AACTCACTGCGCTCGTATAG-3′; 18S rRNA forward: 5′-CCTGGATACCGCAGCTAGGA-3′, 18S rRNA reverse: 5′-GCGGCGCAATACGAATGCCCC-3′.
9
Quantifying HOXB8 Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from cells using TRIzol (Invitrogen) according to the manufacturer’s instructions. Equal amounts of RNA (500 ng) were reverse-transcribed using a cDNA synthesis kit (Promega). Diluted cDNAs (1:5 final) were subjected to qPCR analysis using SYBR Green Supermix reagent (Invitrogen). The relative amount of HOXB8 expression was normalized to an endogenous housekeeping gene GAPDH. Primer sequences: HOXB8-F: 5′-TAA GCG GCG AAT CGA GGT AT-3′; HOXB8-R: 5′-TGT TTC TCC AGC TCC TCC TG-3′. GAPDH: 5′-CCA GCC GAG CCA CATCGC TC-3′ and 5′-ATG AGC CCC AGC CTT CTC CAT-3′.
10
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated using TRIzol reagent (Invitrogen, #15596018) and reverse-transcribed using the cDNA synthesis kit (Promega, #A5001) according to the manufacturer’s instructions. RT-PCR was performed using SYBR green on a C1000 Touch™ Thermal Cycler (Bio-Rad). PCR was performed using AccuPower® HotStart PCR PreMix from Bioneer on an S1000™ Thermal Cycler (Bio-Rad). Primers are listed in Supplementary Table 5 . Sample RNA levels were normalized to that of Gapdh. Calculations were performed by the comparative method 2−∆∆CT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!