P element mediated transformation

Manufactured by BestGene

P-element-mediated transformation is a laboratory technique used to introduce genetic material into Drosophila (fruit fly) cells. It facilitates the integration of exogenous DNA into the host genome, enabling genetic manipulation and study of gene expression in Drosophila.

Automatically generated - may contain errors

Lab products found in correlation

Bdsc 8622, by BestGene (2 mentions) Uas nyfp myc, by BestGene (1 mentions) Uas cyfp ha, by BestGene (1 mentions) Uas nyfp myc vib, by BestGene (1 mentions) Uas cyfp ha sqh, by BestGene (1 mentions) Lr clonase reaction, by Thermo Fisher Scientific (1 mentions) Ap gal4, by Bloomington Drosophila Stock Center (1 mentions) Gmr gal4, by Bloomington Drosophila Stock Center (1 mentions) Ptc gal4, by Bloomington Drosophila Stock Center (1 mentions) Sev gal4, by Bloomington Drosophila Stock Center (1 mentions) Uas gfp, by Bloomington Drosophila Stock Center (1 mentions) Topo cloning, by Thermo Fisher Scientific (1 mentions)

6 protocols using p element mediated transformation

Generating Drosophila Transgenic Lines for Arf1 and Patronin Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols

UAS‐NYFP‐Myc‐Arf1, UAS‐NYFP‐Myc‐Arf1^T31N, UAS‐NYFP‐Myc‐Arf1^Q71L, UAS‐NYFP‐Myc‐Patronin, and UAS‐CYFP‐HA‐Patronin transgenic flies were generated by P‐element‐mediated transformation (BestGene Inc.). BDSC 8622 [yw; P{CaryP}attP2] was used as the injection stock for site‐specific insertion of UAS‐NYFP‐Myc‐Arf1, UAS‐NYFP‐Myc‐Arf1^T31N, UAS‐NYFP‐Myc‐Arf1^Q71L, UAS‐NYFP‐Myc‐Patronin, and UAS‐CYFP‐HA‐Patronin into chromosomal location 68A4 (BestGene Inc.).

Gujar M.R., Gao Y., Teng X., Ding W.Y., Lin J., Tan Y.S., Chew L.Y., Toyama Y, & Wang H. (2023). Patronin/CAMSAP promotes reactivation and regeneration of Drosophila quiescent neural stem cells. EMBO Reports, 24(9), e56624.

+ Open protocol

+ Expand

Generation of Fluorescent Transgenic Flies

Check if the same lab product or an alternative is used in the 5 most similar protocols

UAS-Vib, UAS-Vib::Venus, UAS-VibT63A::Venus, UAS-VibT63E::Venus, UAS-PITPα::Venus, UAS-PITPβ::Venus, UAS-NYFP-Myc, UAS-CYFP-HA, UAS-NYFP-Myc-Vib and UAS-CYFP-HA-Sqh transgenic flies were generated by P-element-mediated transformation (BestGene Inc.). BDSC 8622 [yw; P{CaryP}attP2] was used as the injection stock for site-specific insertion of UAS-NYFP-Myc, UAS-CYFP-HA, UAS-NYFP-Myc-Vib and UAS-CYFP-HA-Sqh into chromosomal location 68A4 (BestGene Inc.).

Koe C.T., Tan Y.S., Lönnfors M., Hur S.K., Low C.S., Zhang Y., Kanchanawong P., Bankaitis V.A, & Wang H. (2018). Vibrator and PI4KIIIα govern neuroblast polarity by anchoring non-muscle myosin II. eLife, 7, e33555.

+ Open protocol

+ Expand

Generating Rab10 Transgenic Flies

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Rab10 coding sequence was PCR-amplified from genomic DNA isolated from; UAS-YFP-Rab10; flies (Zhang et al., 2006 (link)). The PCR product was gel extracted, digested with BamHI and Xhol and cloned into the Gateway pENTR3C Dual Selection Entry Vector (Invitrogen). It was then recombined (LR clonase reaction, Invitrogen) into pTRW (uasT promoter, N-terminal mRFP tag) or pTFW (uasT promoter, N-terminal 3xFLAG tag) (Carnegie Drosophila Gateway Vector Collection). Transgenic flies were generated via P-element-mediated transformation (Best Gene).

Isabella A.J, & Horne-Badovinac S. (2016). Rab10-mediated secretion synergizes with tissue movement to build a polarized basement membrane architecture for organ morphogenesis. Developmental cell, 38(1), 47-60.

+ Open protocol

+ Expand

Fluorescent Genetic Clones in Drosophila Imaginal Discs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fluorescently labeled clones were produced in larval imaginal discs using the following strains: y, w, eyFLP1; Act>y+>Gal4, UAS–GFP; FRT82B, Tub-Gal80 (82B tester) and y, w, eyFLP1; Tub-Gal80, FRT40A; Act>y+>GAL4, UAS-GFP (40A tester). Additional strains used were as follows: GMR-GAL4, ptc-GAL4, ap-GAL4, sev-GAL4, UAS-GFP and puc^E69 (puc-lacZ) were obtained from Bloomington Drosophila Stock Center. UAS-spz^ACT was gift from J.-M. Reichart (Ligoxygakis et al., 2002 (link)). Five independent UAS-Toll-6-IR transgenic lines generated from three different constructs were obtained from Vienna Drosophila Resource Center (VDRC). UAS-spz5^HA was obtained from FlyORF. UAS-egr (Igaki et al., 2002 (link)), UAS-Hep^CA, UAS-dTAK1, UAS-hep-IR, UAS-bsk^DN, UAS-dTAK1^DN and UAS-puc (Ma et al., 2012 (link)) were previously described. UAS-Toll^WT and UAS-Toll-6^ACT-Flag transgenic flies were generated by standard P-element-mediated transformation (Bestgene, Inc.). More than five independent lines were produced and examined for each transgene. Two RNAi lines (v27102 and v27103) were recombined and used to perform experiments unless indicated. Gene expression was verified by immunostaining.

Mishra-Gorur K., Li D., Ma X., Yarman Y., Xue L, & Xu T. (2019). Spz/Toll-6 signal guides organotropic metastasis in Drosophila. Disease Models & Mechanisms, 12(10), dmm039727.

+ Open protocol

+ Expand

Generation of Transgenic Fly Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

UAS-DDB1, UAS-DDB1^RNAi-Res, UAS-Myc-Mahj, UAS-Myc-Mahj^R1120/1123E transgenic flies were generated by P-element-mediated transformation (BestGene).

Ly P.T., Tan Y.S., Koe C.T., Zhang Y., Xie G., Endow S., Deng W.M., Yu F, & Wang H. (2019). CRL4Mahj E3 ubiquitin ligase promotes neural stem cell reactivation. PLoS Biology, 17(6), e3000276.

+ Open protocol

+ Expand

Generating Functional Myt1 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

D. melanogaster cDNA encoding dMyt1 was amplified with primers dMyt forward, CACCATGGAAAAGCATCATCG, and dMyt reverse, TCACTCGTCGTCATATTCCAGGA. Amplified DNA was subcloned into a pENTR vector by TOPO cloning (Invitrogen, Carlsbad, CA) and moved into destination vectors via Gateway recombineering. EGFP-tagged Myt1 was cloned into the UASp vector (Brand and Perrimon, 1993 (link)) for Gal4-inducible germline expression. We also made constructs directly controlled by a testes-specific β2-tubulin (tv3) promoter for expression in mid- to late-stage spermatocytes (Wong et al., 2005 (link)). Similar procedures were used to subclone Cdk1(WT), Cdk1(T14A), Cdk1Y15F), and Cdk1(T14A, Y15F) alleles into the β2-tubulin (tv3)-driven, GFP-tagged vector (a gift from J. Brill, University of Toronto, Canada) and to construct UASp-Wee1;VFP (details available on request). Transgenic strains were generated by P-element–mediated transformation (BestGene, Chino Hills, CA). The UASp-Myt1 reporter was tested for complementation of myt1-mutant bristle defects (Jin et al., 2008 (link)) by expressing EGFP-Myt1 in the sensory organ lineage with neuralized Gal-4 (Yeh et al., 2000 (link)). This fully rescued the myt1 bristle phenotype (100% normal bristles; unpublished data), confirming that EGFP-Myt1 was functional in vivo.

Varadarajan R., Ayeni J., Jin Z., Homola E, & Campbell S.D. (2016). Myt1 inhibition of Cyclin A/Cdk1 is essential for fusome integrity and premeiotic centriole engagement in Drosophila spermatocytes. Molecular Biology of the Cell, 27(13), 2051-2063.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!