Blood samples were obtained and frozen at –80°C until the determination of APOE phenotypes. The purification of human genomic DNA was isolated from peripheral blood using a genome extraction kit (TIANGEN Biotech Co., Beijing, China). APOE genotypes (rs429358 and rs7412) were detected using the ABI real-time Taqman SNP genotyping assay (ABI, Life Technologies, Carlsbad, CA, United States) in accordance with the manufacturer’s instructions. Both SNP112 (rs429358) and SNP 158 (rs7412) are done separately in 2 plates for the same samples and the results were combined for genotypes. Briefly, 1 μL of the DNA samples were added to 10 μL of Taqman Master Mix, 0.25 μL of Taqman SNP genotyping assay probe (rs429358 or rs7412) and 8.75 μL of water. The PCR conditions were denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 10 s, 60°C for 45 s. Finally, the genotypes are combined for APOE genotype of individuals. Subjects with APOE ε2/ε4, ε3/ε4 and ε4/ε4 made up to APOE ε4 carriers group, and subjects with APOE ε2/ε2, ε2/ε3 and ε3/ε3 made up to APOE ε4 non-carriers group.
Genome extraction kit
Manufactured by Tiangen Biotech
Sourced in China
The Genome Extraction Kit is a laboratory tool designed to isolate and purify genomic DNA from a variety of biological samples. It utilizes a simple and efficient protocol to extract high-quality DNA that can be used for various downstream applications, such as PCR, sequencing, and genetic analysis.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Phanta max super fidelity dna polymerase, by Vazyme (1 mentions)
Truseq nano dna sample preparation kit, by Illumina (1 mentions)
Hiseq 4000, by Illumina (1 mentions)
Transstart fastpfu dna polymerase, by Transgene (1 mentions)
4d nucleofector system, by Lonza (1 mentions)
Lightcycler 96 system, by Roche (1 mentions)
Sybr green qpcr kit, by Takara Bio (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Pcr purification kit, by Tiangen Biotech (1 mentions)
Rna extraction kit, by Tiangen Biotech (1 mentions)
2200 tapestation system, by Agilent Technologies (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
Alpha 1 2 ldplus freeze dryer, by Martin Christ (1 mentions)
16 protocols using genome extraction kit
1
APOE Genotyping from Blood Samples
2
Microbial community analysis via 16S rDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA of the consortium was extracted according to the instructions of the genome extraction kit (TIANGEN BIOTECH, China). The primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were used to amplify the V3–V4 region of the 16S rDNA with the Phanta Max Super-Fidelity DNA Polymerase (Vazyme, China) in a 50-µL final volume (Su et al. 2021 (link)). The PCR conditions were as follows: initial denaturation at 95 °C for 3 min; 30 cycles of denaturation at 95 °C for 10 s, annealing at 56 °C for 15 s, and extension at 72 °C for 1.5 min; then final extension at 72 °C for 10 min. The expected length of the PCR product was 1.6 kb. A total of 100 ng purified DNA product was prepared for amplicon sequencing using the NovaSeq platform (Allwegene, China). At least 40,000 reads were acquired for each sample. The sequence data has been deposited in the GenBank database under the BioProject accession number PRJNA888221.
3
Genomic DNA Extraction and Sequencing of P. aeruginosa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA of P. aeruginosa Y12 and P18 were prepared using the Genome Extraction Kit (Tiangen Biotech, Co., Beijing, China). The extracted DNA was dissolved in TE buffer (10 mM Tris–HCl and 1 mM EDTA, pH 8.0), and its concentration and purity were measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States). The total DNA quantity in each sample was ≥10 μg. Next, the genomic DNA was fragmented in a Covaris instrument (Woburn, MA, United States) to an average size of 250–300 nucleotides. Library preparation was done using TruSeq Nano DNA Sample Preparation Kit (Illumina, San Diego, CA, United States), and the libraries were then sequenced using an Illumina HiSeq 4000 instrument (150 bp paired end reads). Sequence-read adapters were removed using Adapter-Removal v 2.1.7 (Schubert et al., 2016 (link)). Low-quality bases were trimmed using a 5 bp sliding window, cutting once the average Phred quality scores to below 30. After trimming, if either read from a pair of reads were <50 bp in length, then both reads were discarded.
4
Generation of MPP2 KO ARPE19 Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the generation of the MPP2 gene knockout ARPE19 cell line, the Lonza 4D Nucleofector Kit (V4XP-3032) was used for nucleofection according to the manufacturer’s recommendations. In brief, Cas9 protein was purchased from Aldveron, and two sgRNAs (SgRNA1: 5′GATCCCTCCCCAGTGCCACG3′; SgRNA2: 5′AAGTCCCATAGTAAGATCCC3′) targeting the MPP2 gene were designed using Benchling software (http://www.benchling.com ) and then synthesized from Synthego. ARPE19 cells were nucleofected with a ribonucleoprotein (RNP) complex (100 pmol Cas9 protein and 300 pmol sgRNA) using a 4D nucleofector system (Lonza) and the DN-100 program. After electroporation, the cells were washed once using 1 × PBS buffer and then cultured in an incubator at 37 °C and 5% CO2. Two days after electroporation, genomic DNA was extracted from several cells using the Genome Extraction Kit (Tiangen, DP304). For determination of the knockout efficiency of the two sgRNAs, the targeted region was amplified using TransStart Fast Pfu DNA polymerase (TransGene Biotech) and sent for Sanger sequencing (forward primer: 5′AGGCCAAGGAAATTGTCCCC3′; reverse primer: 5′CTCCACAAGCTGGCAGTCAA3′). The knockout efficiency was analyzed and quantified from Sanger sequencing data using Inference of CRISPR Edits (ICE) software (http://ice.synthego.com ).
5
Ruminal Microbiome DNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ruminal fluid was thawed in ultrapure water for 20 min, 300 μL aliquots transferred to centrifuge tubes, and total DNA extracted from ruminal microbes using a genome extraction kit (Tiangen Biotechnology Co. Ltd., Beijing, China), according to the manufacturer’s instructions. The concentration and purity of total DNA were measured using a NanoDrop ND-1000 ultramicrospectrophotometer (Thermo Fisher, USA).
Primer sequences are presented inTable 2 and oligonucle otides were synthesized by a subsidiary of Invitrogen (Shanghai, China). Real-time polymerase chain reaction (PCR) assays were performed on a LightCycler 96 system, using its Sequence Detection Software (Roche, Basel, Switzerland). Reactions were performed in triplicate in reaction volumes of 20 μL in optical reaction plates (Roche, Switzerland) sealed with optical adhesive film. Reactions were performed using the LightCycler 96 system, and contained Master Mix (10 μL), 50 to 100 ng genomic DNA (5 μL), PCR grade water (3 μL), forward primer (1 μL), and reverse primer (1 μL). Real-time PCR was carried out according to the manufacturer’s instructions, with the following cycles: pre-incubation at 95°C for 600 s, and 45 cycles of melting at 95°C for 10 s, annealing at 60°C/50°C (Ciliate protozoa) for 60 s, and extension at 72°C for 10 s.
Primer sequences are presented in
6
Quantifying Mouse Telomere Length
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse telomere repeats were measured by real-time quantitative PCR as described84 (link). Briefly, total genome of jejunum was prepared using a genome extraction kit (TianGen, China, DP304). The PCR reaction was run on a CFX-96 real-time PCR detection system (BioRad, USA) with an SYBR Green QPCR kit (TaKaRa, RR820A). The primers (forward primer: 5′-CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT-3′, reverse primer: 5′-GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT-3′) were used to detect telomere. Amplification of 36B4 in the same samples was used as an internal control for detecting telomere length, and the primers (forward primer: 5′-ACTGGTCTAGGACCCGAGAAG-3′, reverse primer: 5′-TCAATGGTGCCTCTGGAGATT-3′) were used to detect 36B4. Relative telomere length was calculated and normalized to values obtained from the amplification of 36B4.
7
APOE Genotyping by Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
APOE allele analysis was conducted using an ABI real-time Taqman SNP genotyping assay (ABI, Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions. Genomic DNA was purified from blood by using a genome extraction kit (TIANGEN, Beijing, China). Genomic DNA was used for allelic determination of SNP 112 (rs429358: GCCCCGGCCTGGTACAC) and SNP 158 (rs7412: GGCACGGCTGTCCAAGGA) of APOE gene. 1 μl of DNA is combined with 10 μl of 1 X final concentration of universal Taq Man PCR Master mix, 8.75 μl of sterilized water and 0.25 μl of primers for SNP 112 (rs429358) or SNP158 (rs7412). Both SNP assays were done separately on 2 plates for the same samples, the results were recorded and combined for genotypes determination.
8
ApoE Genotyping for Alzheimer's Risk
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A single-nucleotide polymorphism genotyping assay was used for the detection of ApoE alleles. Human genomic DNA was extracted and purified using a genome extraction kit (Tiangen Biotech, Beijing, China). We categorized all participants into two subgroups according to their ApoE ε4 status: an ApoE ε4 group, including the ε2/ε4, ε3/ε4, or ε4/ε4 genotypes, and a non-ApoE ε4 group, including the ε2/ε2, ε2/ε3, or ε3/ε3 genotypes.
9
Genome Extraction and CRISPR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the selected monoclonal cell line growing to cell populations, we used the genome extraction kit (Tiangen, Beijing, China) to extract their genomes. We also designed the primers (Table S2 ) to locate ~800 bp upstream and downstream of the target editing site to amplify the target fragment. According to the instructions of T7E1 endonuclease kit (#E001, Viewsolid, Beijing, China), the amplified target fragments were analyzed for gene editing results. Besides, the amplified target fragments were ligated into the pLB vector with subsequent sequencing.
10
Characterization of Bacteriocin-Producing Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In addition to the catalase reaction and carbohydrate fermentation patterns, the bacteriocin-producing strain was characterized and identified based on morphological, biochemical, and physiological characteristics (Vos et al., 2009 (link)). Morphological and physiological identification was examined by Gram staining, shape, and motility through light microscopy. Biochemical identification was based upon the ability to grow at different temperatures and salt concentrations. Finally, genotype identification was confirmed according to 16S rRNA sequence analysis. The PCR reaction primers were as follows: 16S rRNA–F: 5′–AGAGTTTGATCMTGGCTCAG–3′ and 16 rRNA–R: 5′–TACGGYTACCTTGTTACGACTT–3′. Briefly, the whole genome was extracted using a genome extraction kit (TianGen, Beijing, China) and was amplified with initial denaturation for 10 min at 95°C, followed by 30 cycles of 30 s at 94°C, 30 s at 50°C, and 1 min at 72°C, with final extension for 10 min at 72°C. The PCR products were purified by PCR purification kit (TianGen, Beijing, China) and were sequenced by Sangon Biotech (Shanghai, China). The results of DNA sequencing were blasted against the GenBank database1 . Subsequently, software MEGA 7.0 was used for phylogenetic analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!