Plasmids pMD20_p16_M and pMD20_p16_U were used as templates for ORNi-PCR. Alternatively, EpiTect PCR Control DNA Set (QIAGEN, Valencia, CA, USA), bisulfite-treated 293T gDNA, and bisulfite-treated HCT116 gDNA were used as templates for ORNi-PCR. In this regard, the EpiTect PCR Control DNA Set (QIAGEN, Valencia, CA, USA) includes CpG-methylated and bisulfite-treated DNA, and unmethylated and bisulfite-treated DNA. gDNA was extracted from the 293T and HCT116 cell lines and subjected (500 ng of each) to bisulfite treatment using the EZ DNA Methylation-DirectTM Kit (Zymo Research). Alternatively, 293T gDNA (500 ng) was mixed with HCT116 gDNA so that CpG-methylated CDKN2A (p16) accounted for 0–5% of the total CDKN2A (p16), and then the mixture was subjected to bisulfite treatment. After the measurement of its concentration, bisulfite-treated DNA was diluted and used for ORNi-PCR. ORNi-PCR was performed using KOD -Multi & Epi-TM (Toyobo, Osaka, Japan) in mixtures containing 100 fg plasmid DNA or 10 ng bisulfite-treated gDNA, 0.3 μM of each primer, and 1–6 μM ORN in a total volume of 10 μL. ORNi-PCR was performed at various temperatures for the annealing and elongation steps in the presence of different concentrations of ORNs along with a method to determine the optimal conditions [7 (link)]. An established optimal condition is shown in Figure 6 D.
Epitect pcr control dna set
Manufactured by Qiagen
Sourced in Germany, United States
The EpiTect PCR Control DNA Set is a collection of DNA samples for use as controls in epigenetic PCR assays. The set contains DNA samples with different methylation patterns that can be used to validate the performance of PCR-based epigenetic analysis methods.
Automatically generated - may contain errors
Lab products found in correlation
Epitect bisulfite kit, by Qiagen (12 mentions)
Ez dna methylation kit, by Zymo Research (5 mentions)
Ez dna methylation gold kit, by Zymo Research (5 mentions)
Dneasy blood tissue kit, by Qiagen (4 mentions)
Hotstartaq dna polymerase, by Promega (4 mentions)
Dntps, by Promega (4 mentions)
Pyro q cpg software, by Qiagen (3 mentions)
Pyromark gold q96 reagent, by Qiagen (3 mentions)
Pyromark q96 id system, by Qiagen (3 mentions)
Pyromark id pyrosequencer, by Qiagen (2 mentions)
Psq assay design software, by Biotage (2 mentions)
Zymotaq, by Zymo Research (2 mentions)
Pparγ, by Eurofins (2 mentions)
Pyromark wash buffer, by Qiagen (2 mentions)
Pyromark q96 md, by Qiagen (2 mentions)
Pyromark gold q96 cdt reagent kit, by Qiagen (2 mentions)
Agilent tapestation system, by Agilent Technologies (2 mentions)
Pyromark pcr kit, by Qiagen (2 mentions)
Streptavidin coated sepharose beads, by GE Healthcare (2 mentions)
Pyromark assay design version 2, by Qiagen (2 mentions)
45 protocols using epitect pcr control dna set
1
Optimization of ORNi-PCR for DNA Methylation Analysis
2
Methylation Analysis of BAP1 CpG Island
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylation-specific PCR (MSP) was adopted for methylation analysis of the CpG island of BAP1. The UCSC Genome Browser (http://genome.ucsc.edu/cgi-bin/hgGateway ) was used for searching the CpG island of BAP1, and MethPrimer (http://www.urogene.org/methprimer/index1.html ) was utilized for the methylated-specific primer (M primer) and unmethylated-specific primer (UM primer). Sequences of the M primer and UM primer sets are shown in S3 Table .
Bisulfite modification of 2μg of genomic tumor DNA was performed using EpiTect Fast Bisulfite Conversion Kits (QIAGEN) following the manufacturer’s instructions. Approximately 100ng of bisulfite-modified DNA were used as a template for PCR amplification with the M primer and UM primer. The PCR product was confirmed by electrophoresis on a 3% agarose gel. For the control of methylated and unmethylated DNA, EpiTect PCR Control DNA Set (QIAGEN) was used.
Bisulfite modification of 2μg of genomic tumor DNA was performed using EpiTect Fast Bisulfite Conversion Kits (QIAGEN) following the manufacturer’s instructions. Approximately 100ng of bisulfite-modified DNA were used as a template for PCR amplification with the M primer and UM primer. The PCR product was confirmed by electrophoresis on a 3% agarose gel. For the control of methylated and unmethylated DNA, EpiTect PCR Control DNA Set (QIAGEN) was used.
3
Sensitive Methylation Detection in PDAC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The droplet digital PCR (ddPCR) method was employed for sensitive detection of aberrant methylation at target CpG sites of SST in cfDNA isolated from PDAC and normal plasma samples. The list of primer and Taqman probe sequences is provided in Table S3 . All steps including droplet generation, thermal cycling, and droplet reading were performed according to the manufacturer’s protocols (Bio‐Rad). To evaluate the sensitivity of the primer/probe assay for detection of methylated alleles, initial experiments were performed using calibration DNA samples of 100%, 10%, 1%, 0.1%, 0.01%, and 0% methylation that were prepared by mixing control DNA of 100% and 0% methylation (EpiTect PCR Control DNA Set; Qiagen).
4
Prenatal DNA Methylation Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from 0.2 to 1 mL of human peripheral whole-blood from pregnant mothers in the MARBLES study (Markers of Autism in Babies: Learning Early Signs) using the Gentra Puregene Blood Kit (Qiagen cat. 158445). The same protocol was used to isolate DNA from one male human cord blood sample from the MARBLES study, which was assayed 38 times using pyrosequencing. Purified DNA (500 ng) was bisulfite converted using EZ DNA Methylation-Lightning™ Kit (Zymo cat. D5030). Completely methylated and unmethylated DNA standards were obtained from EpiTect PCR Control DNA Set (Qiagen cat. 59695).
5
Validating DNA Methylation Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DM levels measured by the genome-wide methylation array were validated in maternal term (n = 39) and preterm (n = 43) blood by pyrosequencing. The cg04481923 site was amplified using a primer set designed using PSQ Assay Design software (Biotage AB, Uppsala, Sweden) (Table S3 ). Genomic DNA was bisulphite-converted according to the manufacturer’s instructions with an EZ DNA Methylation Kit (ZYMO Research, Irvine, CA, USA). An EpiTect PCR Control DNA Set (Qiagen) was used as a methylated/unmethylated control. The percentage of methylated cells in each region was quantified using the PyroMark ID pyrosequencer (Qiagen) and Pyro Q-CpG Software (Figure S2 ). The software incorporates controls to check for completed bisulphite conversions, and provides an adequate signal over background noise. All samples were run in duplicate and average values were calculated. The details of the pyrosequencing methodology have previously been reported [46 (link), 47 (link)].
6
Methylation Analysis of Tumor Suppressor Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from tissues using a DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer's directions. Sodium bisulfate modification of gDNA was performed using the EZ DNA Methylation-Gold Kit (Zymo Research) following the manufacturer's instructions. The primers for APC, CDH13, MGMT, MLH1 and RUNX3 methylation-specific PCR and PCR conditions are outlined in Table 2 . The EpiTect PCR Control DNA Set (Qiagen) was used as the positive control for the methylated and unmethylated genes. Each PCR was done in a final volume of 25 μL containing 10 ng of bisulfite converted gDNA, 1 × PCR buffer, 0.25 mmol/L deoxynucleotide triphosphate, 400 nmol/L each primer, and 1 unit ZymoTaq (Zymo Research). PCR amplification was done as follows: 95°C for 10 min followed by 40 cycles at 95°C for 30 s, the specific annealing temperature for each gene for 30 s and 72°C for 30s; and, in a final extension step, at 72°C for 7 min. PCR products were resolved by 3% agarose gel electrophoresis and each case was scored as methylated or unmethylated. Since we aimed to investigate the role of methylation we restrictively considered promoter methylation present only if the ratio between methylated/unmethylated band signal was >1. The patients' global methylation scores were calculated by summing the number of methylated genes (range 0–5).
7
Quantitative Methylation Analysis by Bisulfite PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite conversion was conducted using the EpiTect bisulfite kit (Qiagen) according to the manufacturer's instructions. Bisulfite-treated DNA was amplified by primers specific for either methylated (sense, 5′-GTGTTAAAGGGCGGCGTAGC-3′; antisense, 5′-AAAACCCTCACTCGCGACGA-3′) or unmethylated (sense, 5′-TTTTTGGTGTTAAAGGGTGGTGTAGT-3′; antisense, 5′-CACAAAAACCCTCACTCACAACAA-3′) sequences, as previously described (17 (link)). PCR was carried out using MeltDoctor HRM master mix (Applied Biosystems) at 95°C for 10 min (enzyme activation), followed by 39 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min and a final elongation at 72°C for 10 min. All reaction mixtures were run with unmethylated and methylated human bisulfite-treated DNA as controls (Epitect PCR control DNA set; Qiagen). The PCR products were separated by electrophoresis through a 1.5% agarose gel containing ethidium bromide. DNA bands were visualized by UV light.
8
Methylation Analysis of MLH1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturers directions. Sodium bisulfate modification of gDNA was performed using the EZ DNA Methylation-Gold Kit (Zymo Research) following the manufacturers instructions. Modified DNA was amplified in a total volume of 25 L containing 1 Reaction Buffer, 0.25 mM each dNTP, 0.3 M each primer and 1 U ZymoTaq DNA Polymerase (Zymo Research). The primers for MLH1 methylation-specific PCR were for methylated MLH1 fw 5ACGTAGACGTTTTATTAGGGTCGC3 rv 5CCTCATCG TAACTACCCGCG3 and for unmethylated MLH1 fw 5TTTT GATGTAGATGTTTTATTAGGGTTGT3 rv 5ACCACCTCAT CATAACTACCCACA3. PCR was performed for 45 cycles with annealing temperatures of 56C for 30 s and primer extension at 72C for 60 s using 10 ng bisulfite-modified DNA. The EpiTect PCR Control DNA Set (Qiagen) was used as the positive control for the methylated and unmethylated MLH1 gene. PCR products were resolved by gel electrophoresis and each case was scored as methylated or unmethylated.
9
Methylation Analysis of Oligodendrocyte Precursors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from laser-captured OPCs, as well as transfected iPSC-OPCs, and bisulfite-converted, using the Zymo Research EZ DNA Methylation-Direct Kit (BaseClear Lab Products). PCR primers were designed using the PyroMark Assay Design 2.0 software (Qiagen, Supplementary Information S2). The assay for MBP was tested for its sensitivity using the EpiTect PCR Control DNA Set (Qiagen). Product amplification was performed using the following reaction mixture: 1 × buffer with 20 mM MgCl2 (Roche), 10 mM dNTP mix (Roche), 5 μM forward and reverse primers (Metabion AG), 1 U FastStart Taq DNA Polymerase (Roche), bisulfite-converted DNA, and nuclease-free water to a total volume of 25 μl. PCR cycling was performed as follows: initial denaturation for 5 min at 95 °C, 50 cycles of 30 s at 95 °C, 30 s at 60 °C, and 1 min at 72 °C; final extension for 7 min at 72 °C. PCR amplicons were sequenced using the Pyromark Q48 instrument (Qiagen) with the PyroMark Q48 Advanced CpG Reagents (Qiagen), according to the manufacturer’s protocol and quantified with the Pyromark Q48 Autoprep software.
10
Methylation Analysis of MGMT Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using standard phenol/chloroform methods. The purity and concentration of DNA were estimated after collecting absorbance readings at 260/280 nm. DNA (2 μg) was treated with bisulfite (EpiTect Bisulfite Kit, Qiagen, Hilden, Germany). The modified DNA was amplified using primers specific for methylated or unmethylated MGMT gene promoters, as listed in Table S1 . Each PCR mixture contained 1 μl of DNA, 500 nM of primers, 1x reaction buffer containing 1.5 mM MgCl2, and 1 U HotStarTaq DNA Polymerase and 250 mM dNTPs (Promega, USA). PCR was performed with thermal conditions as follows: 95 °C for 10 min, 45 cycles of 95 °C for 30 s, 57 °C for 30 s and 72 °C for 30 s with a final extension of 72 °C for 10 minutes. PCR products were visualized using 1.5% agarose gel, yielding a band of 81 bp for a methylated product and 93 bp for an unmethylated product. Positive methylated and positive unmethylated controls (EpiTect PCR Control DNA Set Qiagen, Hilden, Germany) were included.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!