Total RNA isolated from BV2 cells, spinal cord tissue, and subcutaneous tissue of the hind paw using TRIzol reagent (Thermo Fisher Scientific) was used for the subsequent qPCR verification. In brief, total RNA samples were used for cDNA library preparation using a PrimeScript RT reagent Kit (TaKaRa). mRNA expression was determined by quantitative real‐time polymerase chain reaction (qRT‐PCR) using a SYBR Premix Ex TaqTM II (Tli RNaseH Plus) kit (TaKaRa). qRT‐PCR was performed on the ABI QuantStudio six flex (Applied Biosystems, United States). The PCR reaction was performed as follows: cycling conditions began with an initial DNA denaturation step at 95°C for 20 s, followed by 40 cycles at 94°C for 15 s, 56°C for 30 s, and 72°C for 25 s. Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was the normalization for the quantification of gene expression, using the ΔΔCt method. The primers for mouse genes were synthesized by RiboBio (GuangZhou, China), and sequences can be found in Table 1 .
Sybr premix ex taqtm 2 tli rnaseh plus kit
Manufactured by Takara Bio
Sourced in Japan, China, United States
The SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) kit is a real-time PCR reagent designed for reliable and sensitive detection of target DNA sequences. The kit contains a high-performance DNA polymerase and SYBR® Green I dye for fluorescent detection of amplified products.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (13 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (9 mentions)
Primescript rt reagent kit, by Takara Bio (7 mentions)
Rnaiso plus, by Takara Bio (3 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Primescript high fidelity rt pcr kit, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Abi quantstudio 6 flex, by Thermo Fisher Scientific (1 mentions)
Miscript reverse transcription kit, by Qiagen (1 mentions)
Accuspin micro 17r, by Thermo Fisher Scientific (1 mentions)
Abi 7500 real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Tri reagent protocol, by Takara Bio (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Quantstudio dx real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Rnaiso, by Takara Bio (1 mentions)
35 protocols using sybr premix ex taqtm 2 tli rnaseh plus kit
1
Quantifying Gene Expression in BV2 Cells, Spinal Cord, and Hind Paw
2
Validating miRNA Prognostic Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On the basis of the miRNA microarray results, we further examined miRNA expression using qRT-PCR to analyze the 211 FFPE samples to validate the prognostic value of every candidate miRNA. One microgramme of RNA was reverse-transcribed in 25-mL reactions using the Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. Quantitative real-time PCR (qPCR) was conducted using the SYBR Premix Ex TaqTM II (TliRNaseH Plus) kit (TaKaRa, Japan) with the Bio-Rad (USA) machine. U6 small nuclear RNA was used as internal normalized references. Expression levels of individual miRNA were determined by −ΔCT approach (ΔCT = CT miRNA − CT U6 RNA).
3
Polymyxin B Resistance Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The polymyxin B-resistant subpopulations were collected from the last step. Cultures of parental strains and resistant subpopulations were grown in CAMHB medium without polymyxin B at 37°C with shaking to an OD600 of 0.5. The mRNA of strains was extracted by Trizol method. By the process of RT-PCR using the PrimeScriptTM RT reagent Kit with gDNA Eraser (TAKARA, China), the cDNAs were got. Then the phoP, phoQ, mgrB, pmrA, pmrB, pmrC, and acrB gene expression were detected through quantitative real-time PCR (qRT-PCR) using the SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) kit (TAKARA, China), as previously described (Jayol et al., 2015 (link)). Each experiment was performed in triplicate. The expression of target genes was normalized relative to the RNA polymerase beta subunit gene rpoB. Threshold cycle (Ct) numbers were confirmed by the qRT-PCR system software, and data was analyzed in accordance with the 2–ΔΔCt method. The expression levels of the target genes were compared with those of K. pneumoniae ATCC 700603 (polymyxin B susceptible strain, expression = 1).
4
Quantifying Gene Expression in Spinal Cord
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolated from spinal cord tissue using TRIzol reagent (Thermo Fisher Scientific, USA) was used for the subsequent qPCR verification. In brief, total RNA samples were used for cDNA library preparation using a PrimeScript RT reagent Kit (TaKaRa, China). mRNA expression was determined by quantitative real-time polymerase chain reaction (qRT-PCR) using a SYBR Premix Ex TaqTM II (Tli RNaseH Plus) kit (TaKaRa, Dalian, China). qRT-PCR was performed on the ABI QuantStudio 6 flex (Applied Biosystems, USA). The PCR reaction was performed as follows: Cycling conditions began with an initial DNA denaturation step at 95 °C for 20 s, followed by 40 cycles at 94 °C for 15 s, 56 °C for 30 s, and 72 °C for 25 s. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was the normalization for quantification of gene expression, using the ΔΔCt method. The primers for mouse genes were synthesized by RiboBio (GuangZhou, China), and sequences can be found in Table 1 .
Sequence of primers
| Gene | Primer sequences (5′–3′) | |
|---|---|---|
| Forward | Reverse | |
| GAPDH | TTGCTGTTGAAGTCGCAGGAG | TGTGTCCGTCGTGGATCTGA |
| Ryk | AGCCTTGGACAAAAACACTAGC | GCAAACCCCTACACTGATGTAA |
| Wnt5a | CAACTGGCAGGACTTTCTCAA | CATCTCCGATGCCGGAACT |
| CaMKII | TATCCGCATCACTCAGTACCTG | GAAGTGGACGATCTGCCATTT |
| NFAT | CAGTGTGACCGAAGATACCTGG | TCGAGACTTGATAGGGACCCC |
5
Quantification of miR-26a Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ESFs, hHSFs, HS tissues and NS tissues using TRIzol reagent (Thermo Fisher Scientific, Inc.), and cDNA was synthesized using the miScript Reverse Transcription kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol. The RT conditions were as follows: 16°C for 30 min, 42°C for 30 min, 85°C for 5 min and hold at 4°C. qPCR was used to detect miR-26a and associated mRNA expression using a Bio-Rad machine (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and a SYBR Premix Ex TaqTM II (TliRNaseH Plus) kit (Takara Bio, Inc., Otsu, Japan). The Primer sequences used in qPCR are presented in Table I . The thermocycling conditions were: 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/elongation at 60°C for 30 sec. The expression of miR-26a was analyzed using the 2−ΔΔCq method (21 (link)), normalizing to U6 expression.
6
hMSC RNA Isolation and qRT-PCR Analysis
7
Quantitative Analysis of Antioxidant Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from leaves as described in the TRI reagent protocol (Takara Bio Inc). Primers were designed according to cucumber databases 1 . and NCBI. Gene specificprimers used for real-time quantitative PCR are provided in the following primers: SOD: forward CCTAAACTCTCGTGAATGA and reverse CAGCAGACAAGTATGGATA; POD: forward TTGTAATAATGGCGGCTT and reverse GTGTCATAGAAGGTGGAG; cAPX: forward TGCTTTCATCACCATCAA and reverse TGTTATGTTCTTGTCTTCCT. Actin: forward CCACCAATCTTGTACACATCC and reverse AGACCACCAAGTACTACTGCAC. qRT-PCR was performed on a StepOnePlusTM Real-Time PCR System (Applied Biosystems) using a SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) kit (Takara). The PCR reactions were carried out in triplicate and the thermocycler conditions, 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 60°C for 30 s, and a final extension of 30 s at 60°C. Relative expression was calculated according to the 2-ΔΔCT method, the relative gene expression level was normalized against actin (the internal standard gene).
8
Validating miRNA Profiles in Glioma Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BSG tissue-derived RNA was used to validate the grade-associated miRNAs obtained by bioinformatics analysis. Total RNA was extracted from the tissues and cells using TRIzol reagent. cDNAs were synthesized with Superscript II reverse transcriptase (Invitrogen), according to the manufacturer's instructions. Quantitative real-time PCR (q-PCR) was conducted to detect the miRNA using the SYBR Premix Ex TaqTM II (Tli RNase H Plus) Kit (TaKaRa, Japan) and a QuantStudio™ Dx Real-Time PCR Instrument (Thermo Fisher Scientific, USA). The small nuclear RNA U6 was used as an internal normalization reference for miRNAs. Primers for functional DE-miRNAs and U6 were synthesized by Invitrogen (Shanghai, China). Specific primers are shown in Table S1 . BSG samples were divided into two groups according to WHO grades (grades I and II vs. grades III and IV). Means were compared between the two groups by the Mann-Whitney U test or Student's t-test as appropriate. Statistical significance was defined as p-value <0.05. Analyses were conducted using SPSS software.
9
Quantification of Inflammatory Cytokines in Mouse Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from brain tissues using a total RNA kit (Omega) according to the manufacturer’s instructions. Reverse transcription was performed using a PrimeScriptTM II 1st Strand cDNA Synthesis kit (Takara), and the reaction mix was subjected to quantitative real-time PCR using a SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) kit (Takara) to detect the corresponding mouse interleukin 1 beta (IL-1β), IL-6, tumor necrosis factor alpha (TNF-α), IL-4, IL-10, TGF-β, monocyte chemotactic protein 1 (MCP-1), and macrophage inflammatory protein 1 alpha (MIP-1α) transcription levels. A set of β-actin primers was used as an internal control for each specific gene amplification. The real-time value for each sample was compared using the comparative (CT) method, where the amount of target RNA (2−ΔCT) was normalized to the endogenous actin reference (ΔCT; Schmittgen and Livak, 2008 (link); n = 6 per group). The primers used for quantitative real-time PCR are listed in Table 1 .
10
Quantification of Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells or tissues was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reversely transcribed into cDNAs by using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacture’s protocol. cDNAs were analyzed using qPCR with the SYBR Premix Ex TaqTM II (TliRNaseH Plus) kit (Takara Bio, Inc., Otsu, Japan). GAPDH was used as internal control. The relative gene expression was calculated using the 2−ΔΔCT method. Experiments were performed in triple.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!