Primescript rt reagent kit

Total RNA was extracted from cells with TRIzol reagent (Invitrogen, NY, USA). Chlorophorm isoamylalcohol was added and incubated for centrifugation. The aqueous phase was transferred and precipitated using isopropanol. The RNA pellet was washed with ethanol, air-dried and resuspended in RNase-free water. The concentration of RNA was measured by the spectrophotometer (NanoDrop, #ND-1000). RT-PCR assays were conducted to measure gene expression with a Prime Script RT reagent kit (TIANGEN, Beijing, China). The primers for the genes are listed in Supplementary Table S3. After demonstration that primer sets exert equal and high efciencies, relative expression was analyzed by 2−ΔΔCt method using the transcript levels of hypoxanthine–guanine phosphoribosyl transferase (HPRT) for normalization.

The total RNA of patients’ tissues was isolated from cells using RNA easy fast tissue/cell kit (TIANGEN, China, DP451). Use Prime Script RT reagent kit (TIANGEN, China, KR118-02) for reverse transcription, and then use SYBR Prime Script RT PCR kit (TIANGEN, China, FP209-02) for RT-PCR. Use β-Actin as an internal reference and the 2^-△△Ct method to calculate the results. FOXM1 primer sequences: forward primer 5’- GCTTGCCAGAGTCCTTTTTGC -3’ and reverse primer 5’- CCACCTGAGTTCTCGTCAATGC -3’. β-Actin primer sequences: forward primer 5’- CATGTACGTTGCTATCCAGGC -3’ and reverse primer 5’- CTCCTTAATGTCACGCACGAT -3’.

Total RNA of OC cells and tissues was extracted using TRIzol reagent (Invitrogen, CA, USA). Thereafter, cDNA was synthesized using a PrimeScript RT reagent kit (Tiangen, Beijing, China). RT-qPCR was performed on a 7500 Real Time PCR System (Applied Biosystems, MA, USA) with a program of 95°C for 3 min, and 40 cycles with 95°C for 12 s and 62°C for 40 s. Primers were showed in Table 1. Relative gene expression was calculated using the 2^−ΔΔCt. GAPDH was used as an internal control.

SMMC-7721 cells grown in six-well plates were transfected with plasmids. After 24h, the cells were either treated with 1 μM ZnS for 24 h or left untreated and were then harvested. Total RNA was extracted using TRIzol reagent (Invitrogen, United States) in accordance with the manufacturer’s instructions. Thereafter, cDNA was synthesized from total RNA using a PrimeScript RT reagent kit (Tiangen, China). GAPDH mRNA was used as an internal control. The primer sequences used were as follows. TCONS-00026762 forward primer: 5′-AAT GAG GAG CAG GTT GGA CT-3′, TCONS-00026762 reverse primer: 5′-GAT CAC TTC CTC ACC TGG CT-3'; GAPDH forward primer: 5′-GGT GAA GGT CGG AGT CAA CG-3′, GAPDH reverse primer: 5′-CAA AGT TGT CAT GGA TGA ACC-3'. Finally, the expression was determined using the SYBR@ Green reagent kit (Roche, Indianapolis, IN, United States).

The expression levels of miR-34a-3p and CAB39 were determined by RT-qPCR. Total RNA was isolated from DPSCs using the TRIzol reagent (Invitrogen, Beijing, China) and reverse transcribed to generate cDNA using a PrimeScript RT Reagent Kit (TIANGEN Biotech, Beijing, China) according to the manufacturer's instructions. The RT-qPCR reactions were performed using SYBR-Green PCR Master Mix (TransGen Biotech, Beijing, China) with the ABI7500 System (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The expression of U6 snRNA and β-Actin served as internal controls to normalize the miRNA and mRNA expression levels, respectively. Relative expression levels of miR-34a-3p and CAB39 were calculated using the 2^-ΔΔCT cycle threshold method. The primer sequences used were as follows: miR-34a-3p forward sequence, 5′-CAATCAGCAAGTATACTGCCT-3′, U6 forward sequence, 5′-CGCAAGGATGACACGCAAATTC-3′, and the universal reverse primer sequence of miR-34a-3p and U6, 5′-GTGCAGGGTCCGAGGT-3′; CAB39 forward sequence, 5′-AAATCTCCAGCAGACATTGTG-3′, and reverse sequence, 5′-CAAGTCAATGAGCTGTAAATCA-3′; and β-Actin forward sequence, 5′-CATGTACGTTGCTATCCAGGC-3′, and reverse sequence, 5′-CTCCTTAATGTCACGCACGAT-3′.

Total RNA was isolated from cells during the logarithmic phase using TRIzol (Tiangen Biotech). For mRNA analysis, a cDNA primed by an oligo-dT was constructed using a PrimeScript RT reagent kit (Tiangen Biotech). The PON3 mRNA level was quantified using duplex-qRT-PCR analysis, wherein TaqMan probes with a different fluorescence profile were used to detect β-actin (provided by Shing Gene, Shanghai, China) in a FTC-3000P PCR instrument (Funglyn Biotech). Using the 2^−ΔΔCt method, target gene expression levels were normalized to the β-actin expression level before the relative levels of the target genes were compared.