Qiashredder cell and tissue homogenizer

EBV-positive HEK293 cells were induced in 12-well plates using 125 ng each of Rta and Zta expression plasmids along with 250 ng of the trans-complementing plasmid. 48 hours post lytic induction, cells were washed with phosphate-buffered saline (PBS), and RNA was extracted using GeneJET RNA purification kit (Thermo Scientific) according to manufacturer’s protocol with the following modification: after lysis and before loading on column, lysates was passed through a QIAshredder cell and tissue homogenizer (Qiagen). The eluted RNA was then treated with DNase (1 unit/µg DNA), DNase was deactivated by incubation at 65°C and the treated RNA (~ 1 µg) was reverse transcribed using the ImProm-II Reverse Transcription System (Promega). Purified cDNA was subjected to RT-qPCR with a 7900HT Fast Real-Time PCR system (Applied Biosciences) using SYBR Green Real-Time PCR Master Mix (Biorad). Primers used for detection of β-actin and EBV “BFRF3” (false positive from Fig 1B) are as follows: β-Actin-cDNA-Fwd (GCCGGGACCTGACTGACTAC), β-Actin-cDNA-Rev (TTCTCCTTAATGTCACGCACGAT); FR3-cDNA-qPCR-F (CGGGAGGCTCAAAGAAGTTA), and FR3-cDNA-qPCR-R (GCTCTCTGCCTCTTGTCTATG). All values are reported relative to β-actin mRNA using the 2^-ΔΔC_T method described previously [73 (link)].

EBV-positive 293 cells were induced in 12-well plates using 125 ng each of R and Z expression plasmids along with 250 ng of the trans-complementing plasmid. 48 hours post lytic induction, cells were washed with phosphate-buffered saline (PBS), and RNA was extracted using GeneJET RNA purification kit (Thermo Scientific) according to manufacturer’s protocol with the following modification: after lysis and before loading on column, lysates was passed through a QIAshredder cell and tissue homogenizer (Qiagen). The eluted RNA was then treated with DNase (1 unit/μg DNA), DNase was deactivated by incubation at 65°C and the treated RNA (~ 1 μg) was reverse transcribed using the ImProm-II Reverse Transcription System (Promega). Purified cDNA was subjected to qRT-PCR with a 7900HT Fast Real-Time PCR system (Applied Biosciences) using SYBR Green Real-Time PCR Master Mix (Biorad). The primers used to detect various EBV transcripts and β-Actin are listed in S1 Table.

qPCR was carried out based on previous established protocol (Deshpande et al., 2019 (link)). Primer list can be found in Table S1. In short, cells were harvested from culture and spun down using a centrifuge. Cells were either immediately processed or stored at −80°C for future analysis. mRNA was extracted using the RNeasy Plus Mini Kit (QIAGEN, Cat#74136) and QIAshredder Tissue and Cell Homogenizer (QIAGEN, 79656) according to manufacturer protocol. mRNA concentration was measured using the Varioskan^™ Lux multimode microplate reader (ThermoFisher Scientific). For normalization, 1μg of RNA was used to make cDNA utilizing the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (ThermoFisher Scientific, Cat#K1641) and according to manufacturer thermocycler guidelines. RT-qPCR was then performed at a final volume of 20μL/well using PowerUp^™ SYBR^™ Green Master Mix (10μL, ThermoFisher Scientific, Cat#A25778), forward and reverse primers from IDT (1μL), cDNA (10ng), and nuclease-free water. RT-qPCR reaction was performed on the Applied Biosystems QuantStudio 6 Flex Real-Time PCR System.