X chip protocol

Cells were transfected with Fugene HD (Promega Corporation). After 48 h, ChIP was performed according to the X-ChIP protocol (Abcam) with minor modifications. Briefly, after cell harvesting, 250-μl cell lysates were sonicated as for primary neurons and checked by electrophoresis to give mainly small fragments of 300–500 bp. Lysates were immuno-precipitated with 2-μg mouse anti-HA antibodies (Sigma, H3663) overnight, followed by adding 20-μl DiaMag protein A-coated magnetic beads for 2 h. The complex was washed three times with IP buffer, once with low salt wash buffer and once with TE plus 50-mM NaCl. DNA was eluted and purified according to X-ChIP protocol. Input (3.5%) was used for comparison. DNA fragments were detected by PCR using Hotstart Taq (Qiagen) with specific primers. The sequences of ChIP Primers (5′ → 3′) were:
GBX2-F (TGCTAACTGCAGGATGGAGC) and GBX2-R (CTTGGAGACTCGAGGAAGCC); PRSS16-F (ATGAATCTGTTGGGCTGCGA) and PRSS16-R (TGGGTTTGCTTCCAGTACCC); BDNF-F (GCATTCAGTGGCTGCTTCAAGG) and BDNF-R (GGGCTGCAATGAACAGAGGTC); GRIN2A-F (GCTTAGAAGTGGCAGCCTCA) and GRIN2A-R(AATGCTTCTCCCTGTGCCTC); ACTB-F (GCGCCGCTGGGTTTTATAGG) and ACTB-R (CTCCTCTTCCTCAATCTCGCTC).

ChIP assays were performed according to Abcam X-ChIP protocol with minor modifications. Briefly, 3D-ChIP experiments were conducted on D2.OR cells pooled from 4 wells of a 6-well plate containing 3D-Cultrex cushions (~5 million cells). Cells were immediately fixed in 0.75% paraformaldehyde upon extraction by Cultrex 3D Culture Cell Harvesting Kit. Chromatin shearing was performed by sonicating the samples at 5 watts for 30 sec, followed by 1 min intervals with samples on ice. This procedure was repeated for 28 cycles to yield optimized DNA fragments ranging from 200 bp-1000 bp in length. Twenty-five μg of DNA was used in each IP, which also contained antibodies for TRIM28 (5 μg/IP) or Pol II IP (5 μg/IP) (Table S3). Elution was performed at 65 °C with occasional vortexing for 1 hr. Crosslinks were reversed via overnight incubation at 65 °C after RNase A and Proteinase K treatment, and DNA was isolated with Qiagen PCR purification kit. qPCR of ChIP-enriched DNA was performed as described above and both percent genomic input and fold enrichment compared to beads only control were calculated for each sample. Pausing index was calculated by dividing the fold enrichment of Pol II at the gene body versus its fold enrichment at the transcriptional start site.

ChIP assays were performed according to the X-ChIP protocol from Abcam (http://www.abcam.com/protocols/cross-linking-chromatin-immunoprecipitation-x-chip-protocol), with the following modifications: after formaldehyde fixation, cells were rinsed three times with 10 ml ice cold PBS and centrifuged at 1,200 rpm, 5 min, 4°C. The cell pellet was resuspended in 600 μl lysis buffer per 1x10⁷ cells. For immunoprecipitation, 3–5 μg of specific antibody and 25 μl blocked protein G beads were used (antibodies employed for ChIP analysis are listed in S2 Table). Immunoprecipitated samples were washed three times in low salt wash buffer and three times in high salt wash buffer. Precipitated DNA was isolated using the ChIP DNA Clean and Concentrator Kit (Zymo Research) according to the manufacturer´s manual and analysed by qPCR. DNA enrichment was calculated as percentage of the input. Bar graphs show the mean and standard deviation of at least two independent experiments, each performed in duplicates.
DNA oligonucleotides that were used as primers for ChIP PCR analyses are listed in S1 Table.

Chromatin immunoprecipitation was performed according to Abcam X-ChIP protocol. In brief, AGS cells at 2 × 10⁷ were fixed with 1% formaldehyde for 10 min at room temperature. Cross-linking was stopped by the addition of glycine to a final concentration of 125 mM followed by a 5 min incubation. Cells were harvested and lysed with ChIP lysis buffer. DNA was then sheared by sonication (Diagenode Bioruptor) to 300–700 bp fragments. The cross-linked protein-DNA complex was immunoprecipitated using mouse anti-STAT3 (Cell Signaling, 124H6, #9139). DNA was purified using Qiaquick PCR purification kit (Qiagen). The amount of DNA was quantified by a SYBR green based real-time PCR (Applied Biosystems, StepOne), and the relative enrichment fold-change was calculated using delta Ct.

Chromatin was prepared from primarily cultured lung bronchial epithelial cells, and ChIP assay was performed according to the Abcam X-ChIP protocol. Briefly, cells were fixed with 1% formaldehyde for 10 min and neutralized with 1× glycine. Chromatin lysates were prepared, pre-cleared with Protein-A/G Sepharose beads, and immunoprecipitated with the antibodies against HNF-4α, PGC-1α, or normal rabbit IgG in the presence of bovine serum albumin (BSA) and salmon sperm DNA. The beads were extensively washed three times before reverse crosslinking. The immunoprecipitated DNA was purified using a PCR purification kit (cat. no. K310001; Invitrogen/Thermo Fisher Scientific) and subsequently quantified by real time PCR with the primers (forward: 5′-gctcaagcgaccctcctg-3′, reverse: 5′-catgctgaagtccaaaga-3′) flanking binding sites for HNF4α on the mouse Vnn1 promoter.

ChIP assay was performed according to X-CHIP Protocol (Abcam, Cambridge, UK). Formaldehyde was added to culture medium to a final concentration of 1%. The cells were washed twice with PBS, scraped, and lysed in lysis buffer. Lysates were sonicated on ice and the debris was removed by centrifugation. One-fourth of the supernatant was used as DNA input. The remaining supernatant was diluted 10-fold with dilution buffer and incubated with the indicated antibody in the figures. Immunoprecipitated complexes were collected using protein G sepharose beads. The pellets were washed with dialysis buffer and incubated at 67 ^oC for 5 h to reverse formaldehyde crosslink. DNA was precipitated with ethanol and extracted three times with phenol/chloroform. Pellets were re-suspended in TE buffer and subjected to PCR amplification using the corresponding primers.