Synthetically synthesized sequences for porcine IFNα, IFNβ, SGLuc-IFNα and SGLuc-IFNβ were inserted into the pUC57kan vector (Genscript USA Inc) and subsequently cloned into a modified pTARGET™ vector (mpTarget) for mammalian expression. The sequence for IFNα was inserted into previously constructed Δ1D2A-SGLucΔ1M and SGLuc-Δ1D2A constructs for bi-cistronic vectors [11 (link)]. These constructs differ in whether the luciferase is on the N- or C- terminus of the Δ1D2A Foot-and-Mouth Disease Virus derived translational “skipping” mechanism. For the Δ1D2A-SGLucΔ1M construct the first methionine of SGLuc is also deleted. Plasmids were transformed into NEB® 5-α Competent E. coli (New England Biolabs) and plated on LB Agar plates with 100 μg/mL carbenicillin (Teknova, L1010). Selected colonies were grown in 4 mL of Terrific Broth with 100 μg/mL carbenicillin (Teknova, T7030) overnight at 37 °C, and plasmid purification was performed using QIAprep® Spin Miniprep kit (Qiagen, 27,106). Insertion was validated by sequence analysis using primers mpTarget-F (GACATCCACTTTGCCTTTCTCTC) and mpTarget-R (CTCATCAATGTATCTTATCATGTC). Recombinant plasmid DNAs were purified utilizing a EndoFree Plasmid Maxi kit (Qiagen, 12,362).
Carbenicillin
Manufactured by Teknova
Carbenicillin is a semi-synthetic penicillin antibiotic. It functions as an antimicrobial agent, inhibiting the synthesis of bacterial cell walls.
Automatically generated - may contain errors
Lab products found in correlation
Qiaprep spin miniprep kit, by Qiagen (4 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Repliqa hifi assembly mix, by Quantabio (2 mentions)
Kanamycin, by Teknova (2 mentions)
Midi prep plus kit, by Qiagen (2 mentions)
Kapa real time library amplification kit, by Roche (2 mentions)
Lr clonase 2, by Thermo Fisher Scientific (2 mentions)
Nebnext ultra dna library prep kit for, by Illumina (2 mentions)
Miseq v3 150 cycle kit, by Illumina (2 mentions)
Stbl3 chemically competent cells, by Thermo Fisher Scientific (2 mentions)
Qubit dsdna broad range kit, by Thermo Fisher Scientific (2 mentions)
Isopropyl β d thiogalactoside iptg, by Merck Group (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Carbenicillin, by GoldBio (1 mentions)
Primestar max dna polymerase, by Takara Bio (1 mentions)
One shot stbl3 chemically competent e coli, by Thermo Fisher Scientific (1 mentions)
Nebuilder hifi dna assembly master mix, by New England Biolabs (1 mentions)
Lb miller medium, by Thermo Fisher Scientific (1 mentions)
Lb miller agar, by Thermo Fisher Scientific (1 mentions)
Cacl2, by Merck Group (1 mentions)
13 protocols using carbenicillin
1
Cloning and Expression of Porcine IFN Constructs
2
Plasmid Construction for VEGAS Evolution
3
Escherichia coli Genetic Manipulation Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All assay experiments were performed in the Escherichia coli strain 3.32 (lacZ13(Oc) lacI22 λ−el4- relA1 spoT thiE1; Yale CGSC #5237), transformed chemically, while standard DNA cloning was performed in NEB 5-alpha Competent E. coli (huA2 Δ(argF−lacZ)U169 phoA glnV44 φ80Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17; New England Biolabs) and library construction was performed in electrocompetent E. coli 3.32 cells. Cells were grown in LB Miller Medium (Fisher Scientific) or M9 Minimal Medium (6.8 g L−1 Na2HPO4, 3.0 g L−1 KH2PO4, 0.5 g L−1 NaCl, 1.0 g L−1 NH4Cl, 2 mM MgSO4, 100 μM CaCl2; Millipore Sigma) supplemented with 0.2% (w/v) casamino acids (VWR Life Sciences), 1 mM thiamine HCl (Alfa Aesar). LB Miller + Agar (Fisher Scientific) was used for selection when cloning. Antibiotics and ligands were used as appropriate. Antibiotics used were: chloramphenicol (25 μg mL−1; VWR Life Sciences), kanamycin (35 μg mL−1; VWR Life Sciences), and carbenicillin (100 μg mL−1; Teknova). Ligands used were: fructose (Arcos Organics), d -ribose (Arcos Organics), and isopropyl-β-d -thiogalactoside (IPTG; Millipore Sigma). All ligands in this study were used at a concentration of 10 mM.
4
Cloning and Transformation of mRNA In Vitro Transcription
5
Oral Bacterial Inoculation in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protocol described below was reviewed
and approved by the Harvard Medical Area Standing Committee on Animals
(HMA IACUC, ref. No. IS00000516–3). Twenty-five female 8- to
9-week-old C57BL/6NCrl mice were randomly split into five experimental
cohorts: WT pMUTs, pM1, pM1-VHH, pM2, and pM2-VHH (N = 5). Bacterial suspensions were prepared in advance by growing
to mid-exponential phase (OD600 of 0.5) at 30 °C (shaking
at 225 rpm), pelleting the cells, resuspending to OD600 of 10 in PBS supplemented with 20% sucrose and 10% glycerol, and
flash-freezing in liquid nitrogen. Aliquots of these bacterial suspensions
were stored at −80 °C and allowed to thaw immediately
preceding daily feeding, in order to maintain consistent bacterial
density of the inoculum.
48 h prior to initial administration
of bacteria (day −2), the drinking water was supplemented with
2 g/L carbenicillin (Teknova). Antibiotic-free drinking water was
restored 24 h later (day −1). Starting on day 0, each cohort
was fed 50 μL of its respective bacterial suspension by allowing
the mice to lap the liquid from a pipet tip (as previously described
by Mohawk et al.(53 (link))). Bacterial
administration was carried out daily from day 0 to day 4. Fecal pellets
were collected and weighed daily from day 0 to day 7.
and approved by the Harvard Medical Area Standing Committee on Animals
(HMA IACUC, ref. No. IS00000516–3). Twenty-five female 8- to
9-week-old C57BL/6NCrl mice were randomly split into five experimental
cohorts: WT pMUTs, pM1, pM1-VHH, pM2, and pM2-VHH (N = 5). Bacterial suspensions were prepared in advance by growing
to mid-exponential phase (OD600 of 0.5) at 30 °C (shaking
at 225 rpm), pelleting the cells, resuspending to OD600 of 10 in PBS supplemented with 20% sucrose and 10% glycerol, and
flash-freezing in liquid nitrogen. Aliquots of these bacterial suspensions
were stored at −80 °C and allowed to thaw immediately
preceding daily feeding, in order to maintain consistent bacterial
density of the inoculum.
48 h prior to initial administration
of bacteria (day −2), the drinking water was supplemented with
2 g/L carbenicillin (Teknova). Antibiotic-free drinking water was
restored 24 h later (day −1). Starting on day 0, each cohort
was fed 50 μL of its respective bacterial suspension by allowing
the mice to lap the liquid from a pipet tip (as previously described
by Mohawk et al.(53 (link))). Bacterial
administration was carried out daily from day 0 to day 4. Fecal pellets
were collected and weighed daily from day 0 to day 7.
6
Bacterial Strain Cultivation and Plasmid Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All strains were grown in lysogeny broth (LB), Rich Defined Media (RDM, Teknova) or on LB agar, supplemented with 50 μg ml−1 kanamycin, 100 μg ml−1 carbenicillin or 25 μg ml−1 chloramphenicol (Sigma) for selection. Plasmids were isolated using a QIAQuick Miniprep kit (Qiagen). Polymerase chain reaction (PCR) reaction products were purified using a GeneJet Gel extraction kit (Thermo Scientific) or NucleoSpin Gel and PCR Clean-Up kit (ClonTech). Plasmids and PCR products were sequenced using Sanger sequencing (Elim Biopharma or MCLab). All PCR and cloning reactions were performed on a S1000 Thermal Cycler (Bio-Rad). Information about the E. coli strains used in this experiment can be found in the Supplementary Data .
7
Genetic engineering of ∆argF∆argI E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ∆argF∆argI double knockout E. coli strain was constructed by the Coli Genetic Stock Center at Yale. ATUM Bio supplied the backbone vector (pD884) for cloning. Terrific Broth (TB), M9 minimal medium, carbenicillin (100 mg/mL), kanamycin (50 mg/mL), and Luria broth (LB)/agar plates containing carbenicillin/kanamycin were obtained from Teknova. Ampicillin, L-rhamnose monohydrate, triethanolamine hydrochloride, sulfuric acid, acetic acid, lithium carbamoyl phosphate dibasic hydrate, L-ornithine monohydrochloride, diacetyl monoxime and L-citrulline were purchased from Sigma Aldrich. Thermo Fisher Scientific provided B-PER Complete Bacterial Protein Extraction Reagent, HisPur Ni–NTA spin plates, antipyrine, SYPRO Orange (5000X) dye, Lipofectamine 2000 and the bicinchoninic acid (BCA) assay kit. Novus Biologicals provided the rabbit polyclonal OTC antibody (NBP1-87408) for western blot analysis. All oligonucleotides in this work were purchased from IDT and Q5 DNA polymerase (NEB) was used for all PCR reactions.
8
Inducible Expression and Time-Course Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Glycerol stocks of each library were thawed, and 100uL were grown up overnight in 100 mL MOPS EZ Rich Defined Media (Teknova M2105) with kanamycin (Teknova K2125) and carbenicillin (Teknova C2130). For time course studies, a glycerol stock containing a library of constitutive GFP constructs was also thawed, and 100uL was inoculated into 10 mL of MOPS EZ Rich Defined Media with kanamycin and carbenicillin and grown overnight. The next morning 1 mL of the GFP library was added to the 100 mL of library culture. After mixing GFP and experimental libraries, 1 mL of overnight culture was added to a fresh culture of 100 mL MOPS EZ Rich Defined Media with carbenicillin and kanamycin and the inducers for two hybrid expression: 5 ng/mL anhydrotetracycline, 1.5 uM 2,4-Diacylphlorolglucinol and 100 uM IPTG, done twice for biological replicates, except where indicated (Supplementary Information Section 6 ). Flasks were placed in a 37 C degree shaker for six hours. Samples were pulled after 6 h and placed on an ice slurry to quickly cool for 15 min after which cells were spun down for RNA and DNA extraction.
9
Lentiviral Library of Transcription Factors
10
Recombinant FopA Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All chemicals used in this study were purchased from Millipore Sigma, unless otherwise noted. The fopA gene (FTT0583) from F. tularensis subsp. tularensis strain SCHU S4 was cloned into the BseRI sites of the vector pRSET-C8xHis (DNASU Plasmid Repository accession number EvNO00629010) to generate the expression construct pRSET-FTT0583-His8 (DNASU FtCD00697191), which contains an octa-Histidine tag at the C-terminus. The membrane targeting native signal peptide sequence of FopA was retained in the coding sequence of the fopA gene during cloning (S5 Fig ). The expression construct was transformed [54 (link)] into the E. coli C43(DE3) expression strain and selected for transformants on LB (Luria-Bertani) agar plates with 50 μg/mL carbenicillin (Teknova).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!