Log In Sign up
The largest database of trusted experimental protocols

Pcfd3 du6 3grna

Manufactured by Addgene
Visit Supplier
Sourced in United States

PCFD3-dU6:3gRNA is a plasmid that contains a guide RNA (gRNA) expression cassette. The gRNA is designed to target specific DNA sequences and can be used in CRISPR-Cas9 gene editing applications.

Automatically generated - may contain errors

Lab products found in correlation

Phd dsred attp, by Addgene (3 mentions) Pcfd5, by Addgene (2 mentions) Gibson assembly master mix, by New England Biolabs (2 mentions) Bdsc 55821, by BestGene (2 mentions) Q5 high fidelity 2x master mix, by New England Biolabs (1 mentions) Pcfd3, by Addgene (1 mentions) Vas cas9, by Bloomington Drosophila Stock Center (1 mentions) Pdsred attp, by Addgene (1 mentions) Annealed oligonucleotides, by Integrated DNA Technologies (1 mentions)

14 protocols using pcfd3 du6 3grna

1

Simplified CRISPR Screening for PGRP-LE Δ231

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
To obtain PGRP-LEΔ231::GFP, co-CRISPR strategy (targets: PGRP-LE and ebony e) was used to simplify the screening process.63 (link) Guide RNAs (PGRP-LE: AGTGCTTCCACATTGAGTCG; ebony: CCACAATTGTCGATCGTCA) were cloned into pCFD3–dU6: 3 gRNA (Addgene, 49410).
The y1w1118 PGRP-LE::GFP; attP2{nos-Cas9 y+} embryos were microinjected with guide vectors (pCFD3–dU6:3 gRNA; Addgene # 49410; into which the guide RNAs were cloned) at 100 ng/μL pCFD3 PGRP-LE and 100 ng/μL pCFD3 ebony and the corresponding single strand donor oligonucleotide ssODN at 100 ng/μL. G0 flies were crossed to the double balancer stock def w+/FM6; Sb/TM3Ser, e. Each F1 fly with ebony body color (chrIII: nosCas9∗e/TM3Ser,e) was crossed to the balancer stock FM7/Sqh or Y. Then its gDNA was extracted. PCR and sequencing screenings were performed on each F1 ebony fly in order to identify the potential presence of a deletion of amino acid 231.
Joshi M., Viallat-Lieutaud A, & Royet J. (2023). Role of Rab5 early endosomes in regulating Drosophila gut antibacterial response. iScience, 26(8), 107335.
+ Open protocol
+ Expand
2

CRISPR Plasmid Construction and Transgenesis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
CRISPR targets sites were identified using Target Finder [55 (link)], targetfinder.flycrispr.neuro.brown.edu/.
Complimentary oligonucleotides GTCGGACTTTAAACAATATCGAC and AAACGTCGATATTGTTTAAAGTC, GTCGGCCAGCAGCTCCTCCGAGA and AAACTCTCGGAGGAGCTGCTGGC, GTCGTGGCAGGACGCCGGTGTCC and AAACGGACACCGGCGTCCTGCCA, GTCGGCAAACAACCTGCGCGGCTG and AAACCAGCCGCGCAGGTTGTTTGC, GTCGGACCACTCACCTGTGTATT and AAACAATACACAGGTGAGTGGTC, GTCGTTTCCTGGACGATTTGGAT and AAACATCCAAATCGTCCAGGAAA were annealed and cloned into pCFD3-dU6:3gRNA (Addgene, Watertown USA, cat. #49410), which was digested with BbsI (New England Biolabs, cat. #R0539S). A total of 6 plasmids from pCFD-gRNA1 to pCFD-gRNA6 were constructed. Set plasmids pCFD-gRNA1, pCFD-gRNA2, pCFD-gRNA3 combined with the donor plasmid pLdhGαo23R were used for the first round of transgenesis; pCFD-gRNA4, pCFD-gRNA5, pCFD-gRNA6 together with the donor plasmid hdGαo47ScarlessDsRed—for the second one.
Savitsky M., Solis G.P., Kryuchkov M, & Katanaev V.L. (2020). Humanization of Drosophila Gαo to Model GNAO1 Paediatric Encephalopathies. Biomedicines, 8(10), 395.
+ Open protocol
+ Expand
3

Generating Versatile CRISPR Tools in Drosophila

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
sgRNA expression vectors: for expression of single sgRNAs, oligonucleotide pairs (Supplementary Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410), as described44 . To express multiple sgRNAs from the same vector backbone, oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly, as described45 (link).
Donor vectors for homologous recombination: to generate an eGFP-expressing donor vector (pHD-Stinger-attP), the fluorophore was excised from pStinger46 (link) with NcoI/HpaI and used to replace the DsRed sequence in NcoI/HpaI-digested pHD-DsRed-attP (Addgene plasmid #51019)47 (link). Homology arms (1-1.6 kb) for individual target genes were amplified from D. sechellia (Drosophila Species Stock Center [DSSC] 14021-0248.07), D. simulans (DSSC 14021-0251.195) or D. melanogaster (Research Resource Identifier Database:Bloomington Drosophila Stock Center [RRID:BDSC]_58492) genomic DNA and inserted either into pHD-DsRed-attP or pHD-Stinger-attP via restriction cloning. Details and oligonucleotide sequences are available from the corresponding authors upon request.
Transgenic source of Cas9: pBac(nos-Cas9,3XP3-YFP) (gift of D. Stern) was integrated into D. sechellia (DSSC 14021-0248.07) via piggyBac transgenesis. The insertion was mapped to the fourth chromosome using TagMap48 (link).
Auer T.O., Khallaf M.A., Silbering A.F., Zappia G., Ellis K., Álvarez-Ocaña R., Arguello J.R., Hansson B.S., Jefferis G.S., Caron S.J., Knaden M, & Benton R. (2020). Olfactory receptor and circuit evolution promote host specialisation. Nature, 579(7799), 402-408.
+ Open protocol
+ Expand
4

CRISPR sgRNA Cloning in pCFD3 Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols
sgRNA expression constructs were cloned into the vector pCFD3-dU6:3gRNA (Addgene plasmid #49410, Port et al., 2014 (link)) using established protocols (http://www.crisprflydesign.org/wp-content/uploads/2014/05/Cloning-with-pCFD3.pdf). Sequences of sgRNAs can be found in Supplementary file 1.
Li-Kroeger D., Kanca O., Lee P.T., Cowan S., Lee M.T., Jaiswal M., Salazar J.L., He Y., Zuo Z, & Bellen H.J. (2018). An expanded toolkit for gene tagging based on MiMIC and scarless CRISPR tagging in Drosophila. eLife, 7, e38709.
+ Open protocol
+ Expand
5

CRISPR-mediated PGRP-LE::GFP Transgenic Line

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
A PGRP-LE::GFP fusion protein transgenic line was obtained by inserting, via CRISPR mediated recombination, the meGFP cDNA at the C-term end of the PGRP-LE protein.The vector donor BS PGRP-LE::GFP was obtained by cloning the meGFP cDNA flanked by 1 kb of PGRP-LE homology arms into the Bluescript vector using the following primers: fw5′arm:CGGGCTGCAGGAATTCATAAGCAACTCCACGAACGT, rv5′arm:CTCGCCCTTGCTCACTTGTTCCTCCTCCTCGATATTG; fw3′arm:CAAGCACCGGTCCACGTGAGGGACAAAAGAAGAGCAC, rv3′arm:GGGCCCCCCCTCGAGTGACCAAACGAATGCAGGAC. A co-CRISPR strategy (targets: PGRP-LE and ebony e) was used to simplify the screening process.63 (link) Guide RNAs (PGRP-LE:TCGAGGAGGAGGAACAATGA; ebony: GCCACAATTGTCGATCGTCA) were cloned into pCFD3–dU6: 3 gRNA (Addgene, 49410).w 1118; attP2{nos-Cas9} embryos were injected with donor (500 ng/μL BS PGRP-LE::GFP) and guide vectors (100 ng/μL pCFD3 PGRP-LE; 100 ng/μL pCFD3 ebony). G0 were crossed to the double balancer stock def w+/FM6; Sb/TM3Ser, e. Each F1 with ebony body color (chrIII: nosCas9∗e/TM3Ser, e) was crossed to the balancer stock Sqh/FM7. Then its gDNA was extracted and screened by PCR for GFP presence. Positive lines were confirmed molecularly by sequencing.
Joshi M., Viallat-Lieutaud A, & Royet J. (2023). Role of Rab5 early endosomes in regulating Drosophila gut antibacterial response. iScience, 26(8), 107335.
+ Open protocol
+ Expand
6

Drosophila CRISPR Knockdown Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flies were housed in standard cornmeal/agar medium with yeast under 12:12 h LD (light:dark) cycles. yw flies were used as the wild-type control. Flies used in this study are in SI Appendix, Table S1. CRISPR lines were generated by injecting pCFD3-dU6:3gRNA (Addgene, #49410) or pCFD4-dU6:3tandemgRNAs (Addgene, #49411) containing guide RNAs (gRNAs) corresponding to either the tim promoter or the intronic E-box sequences into embryos using Rainbow Transgenic (Cambridge, MA). tim_in24, tim_up10 were generated by a single gRNA. tim_up122, tim_up126 were generated by tandem gRNAs, the primers used to generate the mutants are listed in SI Appendix, Table S2. The CRISPR-generated deletions were validated by sequencing the region. Fly lines homozygous for the CRISPR-generated tim deletions were used for all subsequent biochemical and behavioral analyses.
Ma D., Ojha P., Yu A.D., Araujo M.S., Luo W., Keefer E., Díaz M.M., Wu M., Joiner W.J., Abruzzi K.C, & Rosbash M. (2024). Timeless noncoding DNA contains cell-type preferential enhancers important for proper Drosophila circadian regulation. Proceedings of the National Academy of Sciences of the United States of America, 121(15), e2321338121.
+ Open protocol
+ Expand
7

PGRP-LE::V5 Fusion Protein Transgenic Fly Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
The PGRP-LE::V5 fusion protein transgenic fly line was obtained by inserting, via CRISPR mediated recombination, a V5-tag cDNA in the 3rd exon of PGRP-LE, upstream of the PGRP domain"TCTdetector".The V5 single-stranded oligo DNA nucleotides donor (ssODN) was synthetized by Eurofins MWG (GATGCATACACGTTAACCATAGGATACCGATTTCACTTACAGAATTCAAAATACCCAAGagcggtggtaagcctatccctaaccctctcctcggtctcgattctacgggtggcGAGCTGTgCGCCATCATTCCGCGCTCTTCGTGGCTAGCACAGAAGCCCATGGACGAG). The guide RNA (ATGATGGCGCACAGCTCCTT), was cloned into pCFD3–dU6:3 gRNA (Addgene, 49410). w1118; attP2(nos-Cas9) embryos were injected with both V5 ssODN donor (100 ng/μL) and pCFD3-gRNA vector (100 ng/μL). G0 were crossed to the balancer stock Sqh/FM7. Each F1 was crossed again to the balancer stock Sqh/FM7. Then its gDNA was extracted and screened by PCR for V5 presence. Positive lines were confirmed molecularly by sequencing.
Joshi M., Viallat-Lieutaud A, & Royet J. (2023). Role of Rab5 early endosomes in regulating Drosophila gut antibacterial response. iScience, 26(8), 107335.
+ Open protocol
+ Expand
8

Generating Fly Lines for dAux Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cloning was performed with the Gibson Assembly Master Mix (New England Biolabs). PCR products were produced with the Q5 High-Fidelity 2x Master Mix (New England Biolabs). Some fragments were ordered as gBlocks at IDT. All inserts were verified by sequencing. Microinjections were performed by BestGene Inc. (CA, USA). We used CRISPR-Cas9 to disrupt genomic dAux gene by injecting vas-cas9 (X chr) flies79 (link) with pCFD3-dU6:3gRNA (Addgene #49410;80 (link)) carrying guide RNA sequences and a pWhiteStar donor plasmid carrying an integrase mediated cassette exchange (IMCE) and a white gene. Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255;81 ) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation) into recombinant vas-cas9:Phi31 flies. Transgenic fly lines were produced by injecting plasmids into VK37 for PhiC31 integrase-mediated site-specific transgenesis.
Jacquemyn J., Kuenen S., Swerts J., Pavie B., Vijayan V., Kilic A., Chabot D., Wang Y.C., Schoovaerts N., Corthout N, & Verstreken P. (2023). Parkinsonism mutations in DNAJC6 cause lipid defects and neurodegeneration that are rescued by Synj1. NPJ Parkinson's Disease, 9, 19.
+ Open protocol
+ Expand
9

Generating Versatile CRISPR Tools in Drosophila

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
sgRNA expression vectors: for expression of single sgRNAs, oligonucleotide pairs (Supplementary Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410), as described44 . To express multiple sgRNAs from the same vector backbone, oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly, as described45 (link).
Donor vectors for homologous recombination: to generate an eGFP-expressing donor vector (pHD-Stinger-attP), the fluorophore was excised from pStinger46 (link) with NcoI/HpaI and used to replace the DsRed sequence in NcoI/HpaI-digested pHD-DsRed-attP (Addgene plasmid #51019)47 (link). Homology arms (1-1.6 kb) for individual target genes were amplified from D. sechellia (Drosophila Species Stock Center [DSSC] 14021-0248.07), D. simulans (DSSC 14021-0251.195) or D. melanogaster (Research Resource Identifier Database:Bloomington Drosophila Stock Center [RRID:BDSC]_58492) genomic DNA and inserted either into pHD-DsRed-attP or pHD-Stinger-attP via restriction cloning. Details and oligonucleotide sequences are available from the corresponding authors upon request.
Transgenic source of Cas9: pBac(nos-Cas9,3XP3-YFP) (gift of D. Stern) was integrated into D. sechellia (DSSC 14021-0248.07) via piggyBac transgenesis. The insertion was mapped to the fourth chromosome using TagMap48 (link).
Auer T.O., Khallaf M.A., Silbering A.F., Zappia G., Ellis K., Álvarez-Ocaña R., Arguello J.R., Hansson B.S., Jefferis G.S., Caron S.J., Knaden M, & Benton R. (2020). Olfactory receptor and circuit evolution promote host specialisation. Nature, 579(7799), 402-408.
+ Open protocol
+ Expand
10

Generation of MS2-tagged transgenes and CRISPR knockouts

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The snail-primary-enhancer_MS2 transgene was obtained by amplification of the sna endogenous promoter and primary enhancer using the primers listed in Supplementary Data 1. The 128XMS2 tag78 (link) was inserted immediately upstream of the yellow reporter gene sequence of the pbphi-yellow plasmid17 (link). The transgenic construct was inserted in the VK0033 landing site (BL9750) using PhiC31 targeted insertion79 (link).
The homology arms for the recombination template for CRISPR/Cas9 editing of scyl gene to generate scyl_24X-MS2_CRISPR were assembled with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in Supplementary Data 1) and inserted into pBluescript opened SpeI/AscI (for the 5’ homology arm) or XmaI/NheI (for the 3’ homology arm) containing the 24X-MS2 (as in ref. 31 (link)) inserted after Not1 digestion. Guide RNA (Supplementary Data 1) were cloned into pCFD3-dU6:3gRNA (Addgene 49410) digested by BbsI using annealed oligonucleotides (Integrated DNA Technology™). The recombination template and guide RNA plasmids were injected into BDSC#55821 (BestGene Inc.). Transformant flies were screened using a dsRed marker inserted downstream of the 3’UTR of the genes.
Bellec M., Dufourt J., Hunt G., Lenden-Hasse H., Trullo A., Zine El Aabidine A., Lamarque M., Gaskill M.M., Faure-Gautron H., Mannervik M., Harrison M.M., Andrau J.C., Favard C., Radulescu O, & Lagha M. (2022). The control of transcriptional memory by stable mitotic bookmarking. Nature Communications, 13, 1176.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!