The strains used for antimicrobial activity determination, E. coli ATCC 25922, E. coli ATCC 078, E. coli UB 1005, Salmonella Typhimurium (S. Typhimurium) C 7731, S. Typhimurium ATCC 14028, P. aeruginosa ATCC 27853, Staphylococcus aureus (S. aureus) ATCC 29213, S. aureus ATCC 25923, Staphylococcus epidermidis (S. epidermidis) ATCC 12228, and Streptococcus faecalis (S. faecalis) ATCC 29212, were all preserved by the Institute of Animal Nutrition, Northeast Agricultural University. The vector pPICZaA was purchased from Liuhe Huada Gene Technology Co., Ltd. (Beijing, China). Restriction endonucleases were obtained from Thermo Fisher Co., Ltd. (Waltham, USA), and SUMO protease was purchased from Gene Copoeia (Guangzhou, China). A plasmid extraction kit was obtained from Genstar (Beijing, China). The Ni–NTA Sefinose (TM) resin kit was purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The purity of other chemical reagents used was of analytical grade.
Ni nta sefinose resin kit
Manufactured by Sangon
Sourced in China
The Ni–NTA-Sefinose resin kit is a laboratory product designed for the purification of recombinant proteins with a histidine tag. The kit contains pre-charged nickel-nitrilotriacetic acid (Ni-NTA) resin, which specifically binds to the histidine tag, allowing for the capture and subsequent elution of the target protein.
Automatically generated - may contain errors
Lab products found in correlation
Plasmid extraction kit, by GenStar (1 mentions)
Restriction endonuclease, by Thermo Fisher Scientific (1 mentions)
Sumo protease, by GeneCopoeia (1 mentions)
Imidazole, by Maclin Biochemical Technology (1 mentions)
E coli top10, by Sangon (1 mentions)
E coli bl21 de3, by Sangon (1 mentions)
Plasmid mini prep kit, by Sangon (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
One step cloning kit, by Vazyme (1 mentions)
Bacterial protein extraction kit, by Sangon (1 mentions)
6 protocols using ni nta sefinose resin kit
1
Antimicrobial Activity Determination Protocols
2
Sphingopyxis sp. USTB-05 Isolation and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sphingopyxis sp. USTB-05 used in this study was isolated and identified by us previously [45 (link)]. Trifluoroacetic acids and methanol were purchased from Dikma Technology Inc. (Lake Forest, CA, USA) and used for HPLC analysis. E. coli TOP10 and E. coli BL21 (DE3) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The recombinant and host strains were cultured in Luria–Bertani medium (tryptone 10 g, NaCl 10 g, yeast extract 5 g in 1 L H2O) in a shaker at 200 revolutions per minute (rpm) at 30 °C. The vector pET30a (+), restriction enzymes Sac I and Not I, plasmid mini-prep kit, polymerase chain reaction (PCR) kit and Ni-NTA Sefinose (TM) Resin Kit were also obtained from Sangon Biotech Co., Ltd. (Shanghai, China). Imidazole was purchased from Macklin Biochemical Co., Ltd. (Shanghai, China). NOD was purchased from Absin Bioscience Inc. (Shanghai, China) and stored at −20 °C. The purity of all other chemicals was no less than 99.7%.
3
Recombinant Expression and Purification of TsSerp
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from MLs using TRIzol (Invitrogen, USA). The full-length TsSerp cDNA sequence was amplified by PCR using specific primers carrying restriction enzyme sites for BamHI and HindIII (bold ) (5′-GCGGATCC CAGTATTGTGGAAATCCTTATTTT-3′; GCGGCGAAGCTT TCAGTAAAAAGAGTCAAAATT’). The PCR products were cloned into the expression vector pET-32a, and then the recombinant pET-32a/TsSerp plasmid was transformed into Escherichia coli BL21 (DE3) (Novagen, USA). rTsSerp was expressed by induction with 0.5 mM IPTG for 4 h at 25 °C, with the formation of insoluble inclusion bodies [34 (link)]. The inclusion bodies were recovered from the bacterial lysates by centrifugation at 12,000 × g for 10 min and dissolved in 8 M urea. rTsSerp was purified using Ni–NTA-Sefinose resin kit (Sangon Biotech Co., Shanghai, China). After purification, the purified rTsSerp was renatured by gradient dialysis [35 (link), 36 (link)]. The protein concentration of purified rTsSerp was determined and analysed by SDS-PAGE and western blotting as previously reported [37 (link)].
4
Recombinant Expression and Purification of TsENO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequences for TsENO and its site-specific mutant sequence were chemically synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and introduced into Escherichia coli. The synthesized coding sequences harbouring BamHI and PstI restriction enzyme sites were cloned into the prokaryotic expression vector pQE-80L with one step cloning kit (Vazyme, Nanjing, China). Recombinant pQE-80L/TsENO and its variant were transformed into E. coli BL21 (DE3) (Novagen, La Jolla, USA). The expression of rTsENO and its mutant (M-rTsENO) was induced for 5 h at 30 °C by using 0.5 mM isopropyl β-d -1-thiogalactopyranoside (IPTG). The rTsENO and M-rTsENO proteins were purified using a Ni–NTA sefinose™ resin kit (Sangon Biotech, Shanghai, China). The concentrations of the purified proteins were measured by the bicinchoninic acid (BCA) method, and the recombinant proteins were then analysed by SDS-PAGE with 12% acrylamide separating gels.
5
Recombinant BaDyP Protein Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cloning, expression, and purification of recombinant BaDyP were performed according to protocols described in our previous work (Yang et al., 2019 (link)). pET30a-efeb was transformed into E. coli BL21 (DE3). Recombinant BaDyP was induced with 0.8 mm IPTG at 16°C. After 12 h, cells were collected and treated by sonication. The recombinant BaDyP in the soluble fraction was extracted and purified with Ni-NTA sefinose resin kit (Shanghai Sangon Biotech Co., Ltd., China).
The activity of BaDyP was assayed according to the oxidation of ABTS. To 1.9 ml tartrate buffer (pH 3, 50 mm) containing ABTS (10 mm), a volume of 0.1 ml BaDyP solution was added. The reaction was initiated by the addition of H2O2 (50 mm). The reaction was kept for 5 min at 25°C and the oxidation of ABTS to its cation radical was measured using a U-1600 UV–vis spectrometer (MAPADA, China) at 420 nm. One activity unit (U) of BaDyP was defined as the amount of enzyme required to oxidize 1 mmol of ABTS per minute.
The activity of BaDyP was assayed according to the oxidation of ABTS. To 1.9 ml tartrate buffer (pH 3, 50 mm) containing ABTS (10 mm), a volume of 0.1 ml BaDyP solution was added. The reaction was initiated by the addition of H2O2 (50 mm). The reaction was kept for 5 min at 25°C and the oxidation of ABTS to its cation radical was measured using a U-1600 UV–vis spectrometer (MAPADA, China) at 420 nm. One activity unit (U) of BaDyP was defined as the amount of enzyme required to oxidize 1 mmol of ABTS per minute.
6
Cloning and Purification of DgbZIP2 and DgbZIP3 Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length DgbZIP2 and DgbZIP3 were cloned into the pET28a expression vector to form fusion expression plasmids pET28a-DgbZIP2 and pET28a-DgbZIP3. The fusion plasmids pET28a-DgbZIP2 and pET28a-DgbZIP3 were transformed into chemically competent cells, and the protein was induced with 0.5 mM isopropyl β-d -1 thiogalactopyranoside (IPTG). The protein was extracted from the bacterial solution according to the instructions of the Bacterial Protein Extraction Kit (Sangon Biotech,
Shanghai, China). The Ni-NTA Sefinose™ Resin Kit (Sangon Biotech,
Shanghai, China) was used to purify the proteins. EMSA analysis was used to select a 54-bp DNA fragment containing a G-box (CACGTC) and A base at the 5′ end in the promoter part of DgPOD, and a 6-FAM tag was added at the 5′ end; the competitive probe had the same sequence, and no 6-FAM tag was added to the 5′ end; the mutation probe had the same sequence, all of the bases in G-box (CACGTC) were mutated to A, and the 6-FAM tag was added to the 5′ end. The negative control was His protein. The above probes were all constructed by Sangon Biotech.
Shanghai, China). The Ni-NTA Sefinose™ Resin Kit (Sangon Biotech,
Shanghai, China) was used to purify the proteins. EMSA analysis was used to select a 54-bp DNA fragment containing a G-box (CACGTC) and A base at the 5′ end in the promoter part of DgPOD, and a 6-FAM tag was added at the 5′ end; the competitive probe had the same sequence, and no 6-FAM tag was added to the 5′ end; the mutation probe had the same sequence, all of the bases in G-box (CACGTC) were mutated to A, and the 6-FAM tag was added to the 5′ end. The negative control was His protein. The above probes were all constructed by Sangon Biotech.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!