Retroscript

Manufactured by Thermo Fisher Scientific

Sourced in United States

Retroscript is a reverse transcription kit used to synthesize first-strand cDNA from RNA templates. It contains all the necessary components for efficient cDNA synthesis, including reverse transcriptase enzyme, reaction buffer, and random hexamer primers.

Automatically generated - may contain errors

Lab products found in correlation

29 protocols using retroscript

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted as previously described (Tollervey, 1987 (link)). Prior to the conversion to cDNA, 10 µg of total RNA was treated with Turbo-DNA free (Ambion) according to the manufacturer's protocol. For the Ribosys experiments cDNA was prepared from 5 µg of the DNase treated RNA using Retroscript (Ambion) with random decamers. cDNA was then diluted 1/20. qPCRs were performed in triplicate with Sensimix SYBR low-rox kit (Bioline) in a Stratagene MX3005P real-time PCR machine. Cycling parameters were 2 min at 94°C, then 50 cycles of 10 s at 94°C, 10 s at 63°C and 20 s at 72°C. For the endogenous transcripts, cDNA was prepared from 5 µg of the DNase treated RNA using Retroscript (Ambion) with oligodT. cDNA was then diluted 1/20. qPCRs were performed in triplicate with Sensimix SYBR low-rox kit (Bioline) in a Stratagene MX3005P real-time PCR machine. Cycling parameters were 10 min at 95˚C, then 40 cycles of 15 s at 95˚C, 15 s at 55˚C and 15 s at 72˚C.

Milligan L., Sayou C., Tuck A., Auchynnikava T., Reid J.E., Alexander R., Alves F.D., Allshire R., Spanos C., Rappsilber J., Beggs J.D., Kudla G, & Tollervey D. (2017). RNA polymerase II stalling at pre-mRNA splice sites is enforced by ubiquitination of the catalytic subunit. eLife, 6, e27082.

+ Open protocol

+ Expand

Colon RNA Isolation and RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from the colon samples was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Total RNA (2 µg) was reverse transcribed using a RETROscript® reverse transcription kit (Invitrogen, Carlsbad, CA). RT-PCR was performed with an ABI Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA) using TaqMan primers (Thermo Fisher Scientific, MA) and PCR Master Mix. Amplification of GAPDH was used as an internal control. Relative mRNA expression was quantified using the comparative CT (Ct) method and expressed as 2^(−ΔΔCt). The primers used were as follows: TNF-α (Mm00443258_m1), IL-17A (Mm00439618_m1), IL-6 (Mm00446190_m1), IFN-γ (Mm01168134_m1), IL-1β (Mm00434228_m1), IL-18 (Mm00434226_m1), HO-1(Mm00516005_m1), GCLM (Mm01324400_m1), GPX2 (Mm00850074_g1) and SOD2 (Mm01313000_m1).

Yang N., Xia Z., Shao N., Li B., Xue L., Peng Y., Zhi F, & Yang Y. (2017). Carnosic acid prevents dextran sulfate sodium-induced acute colitis associated with the regulation of the Keap1/Nrf2 pathway. Scientific Reports, 7, 11036.

+ Open protocol

+ Expand

Zebrafish Map1b Cloning and Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from 24 hpf AB embryos using TRIzol (Invitrogen, cat no. 15596–026). cDNA was synthesized with RETROscript (Invitrogen, cat no. AM1710) and oligodT primers. Primers were designed to amplify a conserved, 302 bp region of zebrafish map1b corresponding to exon 5 (accession # XM_003198629):

Forward primer: 5’-AGCACCGTACATCCAGCCAACA-3’

Reverse primer: 5’-GCAAACAATGCAGAGTCACCCCGT-3’

PCR was performed using PfuUltra (Agilent Technologies, cat no. 600385) and products were cloned into PCR II-TOPO vector (Invitrogen, cat no. K4600-01).
The δmap1b construct, a codon optimized sequence encoding the first 571 aa of zebrafish Map1b, was synthesized by Genewiz based on the published zebrafish map1b sequence (accession # XM_003198629). δmap1b was subsequently subcloned into the pCS2+ vector.

Jayachandran P., Olmo V.N., Sanchez S.P., McFarland R.J., Vital E., Werner J.M., Hong E., Sanchez-Alberola N., Molodstov A, & Brewster R.M. (2016). Microtubule-associated protein 1b is required for shaping the neural tube. Neural Development, 11, 1.

+ Open protocol

+ Expand

Quantifying mRNA Levels in C. elegans

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from synchronized 2d old C. elegans adults using Trizol (Invitrogen) followed by chloroform extraction and isopropanol precipitation. Samples were DNase treated with Turbo DNA-free (Invitrogen) and cDNA was synthesized from 1μg total RNA using Retroscript (Invitrogen). Quantitative RT-PCR assays of mRNA (SYBR Green, Bio-Rad) levels were done according to Bio-Rad recommendations. Three independent biological samples were used for all strains analyzed for gfp levels, and we used rpl-32 levels for normalization across samples. The 2^−ΔΔct method was used for comparing relative levels of mRNAs. Primers are listed as Supplementary information.

Garcia S.M., Tabach Y., Lourenço G.F., Armakola M, & Ruvkun G. (2014). Identification of genes in trinucleotide repeat RNA toxicity pathways in C. elegans. Nature structural & molecular biology, 21(8), 712-720.

+ Open protocol

+ Expand

Quantifying Human Placental Cell mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Using an RNAqueous-Micro isolation kit (Ambion, Austin, TX), total RNA was isolated from primary cultures of human TDCs, CTBs, and STBs as well as choriodecidual explant cultures, per manufacturer's instructions. Reverse transcription was performed using the Retroscript (Invitrogen), as follows: template RNA and random primers were incubated at 65 C for 5 minutes (to eliminate any secondary structures). After adding the buffer and enzyme, the reaction was performed at 42 C for 1 hour. qPCR was performed using TaqMan gene expression assays for CSF2, CSF2RA, matrix metalloproteinase (MMP) 3, 7, or 9, as well as IL-1B, IL-6, or IL-8 (Applied Biosystems, Foster City, CA) (Table 2). All samples were run in triplicate. Expression of the target mRNAs was normalized to b-actin mRNA levels and the 2 ÀDDCT (cycle threshold) method was used to calculate relative expression levels.

Sinkey R.G., Guzeloglu-Kayisli O., Arlier S., Guo X., Semerci N., Moore R., Ozmen A., Larsen K., Nwabuobi C., Kumar D., Moore J.J., Buckwalder L.F., Schatz F., Kayisli U.A, & Lockwood C.J. (2020). Thrombin-Induced Decidual Colony-Stimulating Factor-2 Promotes Abruption-Related Preterm Birth by Weakening Fetal Membranes. The American journal of pathology, 190(2).

+ Open protocol

+ Expand

Identification of ADP7 Peptide Transcript

Check if the same lab product or an alternative is used in the 5 most similar protocols

Incisors and molars from 3-days old postnatal pups were isolated by dissection. Total RNA was extracted using TRizol Plus RNA purification kit (Invitrogen). First strand cDNA was synthesized using a reverse transcription kit (RETROscript, Invitrogen). The complementary DNA (cDNA) product was expanded using polymerase chain reaction (PCR) with an ADP7-specific primer set consisting of a forward primer located on the amelogenin first exon (5’-ATCAAGATCC CTGAGCTTCA GAC-3’) and a reverse primer located on 3’-end of the ADP7 minigene (5’-TGTTGGGTTG GAGTCATGGA GTGG-3’) (Table 1). Cloning of the amplified products was performed by ligation into a TA-cloning vector (Invitrogen), followed by amplification and DNA recovery for nucleotide sequencing to confirm identity of the transcript as the 42 amino acid ADP7 peptide.

Geng S., Lei Y, & Snead M.L. (2021). Minimal amelogenin domain for enamel formation. JOM (Warrendale, Pa. : 1989), 73(6), 1696-1704.

+ Open protocol

+ Expand

Quantifying Parasite Burden in Infected Mouse Livers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The parasite burden in infected mouse livers was determined with qPCR quantification of parasite 18s rRNA. Mice were infected i.v. with 10,000 sporozoites. 42 hours post infection, the mice were sacrificed, and the livers harvested. They were washed briefly in PBS before homogenization in TRIzol. Liver homogenates were diluted 1:1 in TRIzol and stored at -80°C. mRNA was extracted using the Direct-zol RNA MiniPrep Plus kit according to the manufacturer’s protocol. The extracted mRNA was diluted to 2ng/μl. cDNA was generated using RETROscript (Invitrogen) according to the manufacturer’s protocol. Relative parasite burden was determined via quantitative PCR by comparing the mean Ct value of the P. berghei 18s ribosomal subunit (Gene ID: 160641) to the mean Ct value of the Mus musculus gapdh (Gene ID: 281199965) in the generated cDNA.

Gabelich J.A., Grützke J., Kirscht F., Popp O., Matz J.M., Dittmar G., Rug M, & Ingmundson A. (2022). A member of the tryptophan-rich protein family is required for efficient sequestration of Plasmodium berghei schizonts. PLoS Pathogens, 18(9), e1010846.

+ Open protocol

+ Expand

Quantifying mRNA Levels in C. elegans

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from whole retinas using the Trizol method as described previously⁷². Briefly, 2 μg of total RNA was reverse transcribed using Retroscript (Ambion AM1710) to generate cDNA. The cDNA samples were diluted 1:100 and real time PCR was performed in triplicates for each primer using Sybr Green PCR master mix (Thermo fisher #4309155). The real time PCR primers (Supplemental Tables 1, 2) were designed using NCBI Primer-Blast and were specific for each target gene. Reactions were quantified using an ABI Step One Plus Real Time PCR and analyzed with the corresponding software. Relative expression levels were determined by normalizing cycle threshold values to the amount of β-actin expressed (1000/2åCt gene – Ct β-actin). Statistical significance of differential expression was assessed using a T-test and P-value of <0.05. Results are mean ± SEM. N=7. Primers amplifying SV40 from AAV8 vector were used to determine exogenous Nr2e3 expression (F:AGCAATAGCATCACAAATTTCACAA; R:CCAGACATGATAAGATACATTGA).

Li S., Datta S., Brabbit E., Love Z., Woytowicz V., Flattery K., Capri J., Yao K., Wu S., Imboden M., Upadhyay A., Arumugham R., Thoreson W.B., DeAngelis M.M, & Haider N.B. (2020). Nr2e3 is a genetic modifier that rescues retinal degeneration and promotes homeostasis in multiple models of retinitis pigmentosa. Gene Therapy, 28(5), 223-241.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Retinal Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression analysis was performed using quantitative RT-PCR as previously described [32] (link). In brief, retinas were dissected rapidly after eye enucleation and placed in Trizol (Life Technologies, Carlsbad, CA) for RNA extraction. Eyes were consistently collected in the early afternoon for each animal in order to eliminate variability due to circadian expression. Two micrograms of total RNA was reverse transcribed using Retroscript (Ambion, Austin, TX). Real-time PCR was performed in technical triplicates with a minimum of three biological replicates using SYBR Green PCR master mix (Applied Biosystems, Warrington, UK). The following primer were used: Nr1d1 (F: CGGCTCAGCGTCATAATGAA, R: GTTGCCTTGCCGTAGACTGTT); Opn1sw (F: ACCTCTAACAATGGGCTGTGTGA, R: GCTGCCGAAGGGTTTACAGA); Gnat2 (F: CCAGCTGGACCGGATTACAG, R: CAGGTGACTCCCTCGAAGCA) and β-Actin (F: ATGCCTCCCCTACCAATCTTC, R: GGATAACGTCCAGGGAACCA). Reactions were quantified using a Roche 480 LightCycler real time PCR instrument. Relative expression levels were normalized to the amount of β-Actin expressed and fold change relative to wild-type C57BL/6J control was calculated using the delta Ct method. Standard error was calculated to determine statistical significance.

Cruz N.M., Yuan Y., Leehy B.D., Baid R., Kompella U., DeAngelis M.M., Escher P, & Haider N.B. (2014). Modifier Genes as Therapeutics: The Nuclear Hormone Receptor Rev Erb Alpha (Nr1d1) Rescues Nr2e3 Associated Retinal Disease. PLoS ONE, 9(1), e87942.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!