In situ hybridization (ISH) was performed on paraffin sections as described previously [23 (link)], with the exception that the hybridization buffer did not contain heparin and yeast total RNA. vmhcl, amhc, nppb, tnnt2a, and col6a1 probes were previously generated [24 (link)]. Primers for the postnb probe generation were forward primer AGAGGTTCTGGACAGGCTCA and reverse primer AAGGCACCATTTTTCACCAG. Haematoxylin and eosin (H&E) staining and acid fuchsin-orange staining (AFOG) were performed on paraffin and cryosections, respectively, in accordance with standard laboratory protocols. Imaging of stained sections was performed using Leica DM4000 B LED upright automated microscope and Olympus Slideview VS200 digital slide scanner.
Slideview vs200
Manufactured by Olympus
Sourced in Japan, Germany
The SLIDEVIEW VS200 is a digital slide scanner developed by Olympus. It is designed to digitize glass microscope slides and convert them into high-resolution digital images for various applications, such as digital pathology and research. The SLIDEVIEW VS200 utilizes advanced optical and imaging technologies to capture detailed images of slide specimens.
Automatically generated - may contain errors
Lab products found in correlation
Tcs sp8, by Leica camera (3 mentions)
Orca flash4.0 v3, by Hamamatsu Photonics (2 mentions)
Lsm 880, by Zeiss (2 mentions)
Lsm 780, by Zeiss (2 mentions)
Immpacttm dab, by Vector Laboratories (1 mentions)
Cd11b, by Cell Signaling Technology (1 mentions)
Inverted fluorescence microscope, by Nikon (1 mentions)
Alexa fluor 647, by Abcam (1 mentions)
Ab53444, by Abcam (1 mentions)
Ab5076, by Abcam (1 mentions)
Goat serum, by Thermo Fisher Scientific (1 mentions)
Sp8 lscm, by Leica camera (1 mentions)
Ab178846, by Abcam (1 mentions)
Donkey anti rat alexafluor 594, by Jackson ImmunoResearch (1 mentions)
Alexa fluor 488 donkey anti rabbit, by Thermo Fisher Scientific (1 mentions)
Tissue freezing medium, by Leica camera (1 mentions)
Alexa 555 anti rabbit, by Thermo Fisher Scientific (1 mentions)
Collagenase type 2, by Thermo Fisher Scientific (1 mentions)
Anti phospho histone h3 ser10, by Merck Group (1 mentions)
Cryostar nk70, by Thermo Fisher Scientific (1 mentions)
49 protocols using slideview vs200
1
In Situ Hybridization and Tissue Staining
2
Quantitative Analysis of Immunostained Specimens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The immunostained specimens were quantified using image analysis software, QuPath [21 (link)]. In brief, after whole‐slide scanning of the immunostained specimens using Slideview VS200 (Olympus Corporation), the images were opened with QuPath software, dearrayed, and deconvoluted into hematoxylin and DAB images. For CD3‐, CD8‐, CD68‐, and CD163‐stained specimens, ‘positive cell detection’ was performed in QuPath. For CD24‐ and MYC‐stained specimens, H‐scores [22 (link)] were calculated for each TMA core based on the extent and intensity of cytoplasmic staining (3 × % of strongly staining cytoplasm + 2 × % of moderately staining cytoplasm + 1 × % of weakly staining cytoplasm, giving a range of 0–300).
3
Immunohistochemistry Protocol for Tissue Sections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues were embedded in paraffin and mounted on slides. The slides were deparaffinized in xylene solution and rehydrated in ethanol. Antigen retrieval was performed in sodium citrate buffer by heating in microwave for 10 min and cooling at room temperature. The slides were permeabilized in 0.1% Triton X-100 for 5 min, blocked by 10% FBS for 1 h. Next, the slides were incubated with primary antibodies overnight at 4 °C, followed by washing with 0.1% PBST and incubating with ImmPRESSTM HRP secondary antibody for 1 h at room temperature. The slides were washed and stained with ImmPACTTM DAB (VECTOR, SK-4105), counterstained with hematoxylin, dehydrated through sequential ethanol grading, cleared in xylene and mounted. The slides image was observed by OLYMPUS SLIDEVIEW VS200.
4
Quantifying Immune Cells in Pancreatic Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pancreatic tissues were stained with standard H&E preparations. Immunohistochemical analysis of paraffin-embedded pancreatic tissue was performed with an antibody specific for CD11b (Cell Signaling Technology) and CD8a (Proteintech). Immunostained tissues were photographed using a SLIDEVIEW VS200 (Olympus), and the average number of stained cells per field (total 3 fields, 2.6mm2 per field) was quantified.
5
Quantification of Fos-GFP-Positive Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fluorescent images were acquired using light microscope (SLIDEVIEW VS200, Olympus, Tokyo, Japan) at the 20X objective. The laser with a wavelength of 488 nm was used for GFP excitation and 358 nm was used for DAPI. The number of Fos-GFP-positive, and DAPI-positive cells in a set region of interest (ROI) were quantified manually with ImageJ (https://imagej.nih.gov/ij/ ). The size of the ROI was standardized across brains, animals, experiments, and groups. All cell counting experiments were conducted blind to experimental group. To calculate the percentage of overlapping cells we counted the number Fos-GFP -positive cells and divided by the total number of DAPI-positive cells.
6
Histological Analysis of Murine Femurs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For histologic analysis, femurs were harvested from mice and fixed in 4% PFA overnight at room temperature. Femurs were decalcified with 14% EDTA for 2 weeks. Paraffin-embedded and sectioned at 7 μm thickness using a paraffin microtome after decalcification and dehydration. Hematoxylin and eosin (H&E) and Masson staining were performed on paraffin sections. Stained images of the paraffin section were acquired by SLIDEVIEW VS200 (Olympus, Tokyo, Japan).
7
Spinal Cord IHC Analysis of Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IHC experiment was undertaken following behavioral experiments. Under isoflurane anesthesia, the spinal cord was harvested after pre-fixation performed by injecting 100 mL of 0.9% saline and 200 mL of 4% paraformaldehyde into the heart. After fixation, tissue was placed in 4% paraformaldehyde for 72 hours. Then, specimens were dehydrated, embedded in paraffin, and sliced. Slices were dewaxed, hydrated, antigenic repair, blocked, and then incubated overnight at 4 °C with primary antibody. Then, they were incubated for 50 min at room temperature with HRP conjugated secondary antibody followed by DAB colored and microscopic examination (Olympus, SLIDEVIEW™ VS200, Tokyo, Japan). The primary antibodies for Anti-TNF-α (1:100) and anti-p-NF-kB p65 (ser536) (1:100) were applied.
8
Immunofluorescence Staining of Cells and Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The treated cells were fixed and blocked in blocking buffer (1 × PBS, 5% BSA, 0.01% Triton X-100) for 1 h. After incubated with primary antibodies (1:200) at 4 °C overnight, cells were washed with PBS 5 times, stained with fluorophore-conjugated secondary antibodies (1:500) at room temperature for 90 min and counter-stained with DAPI for 2 min. After washed 5 times, the cells were observed with a confocal laser scanning microscope (LSM880, Zeiss, Oberkochen, Germany).
For tumor tissue sections, the sections were rehydrated, washed and blocked in blocking buffer (1 × PBS, 5% anti-goat serum, 0.01% Triton X-100) for 1 h, and then incubated with primary antibodies (1:200) at 4 °C overnight. Sections were then washed with PBS 5 times and stained with fluorophore-conjugated secondary antibodies (1:500) at room temperature for 90 min. After washed 5 times, samples were observed with a scanning microscope (Slideview VS200, Olympus, Lake Success, NY, USA).
For tumor tissue sections, the sections were rehydrated, washed and blocked in blocking buffer (1 × PBS, 5% anti-goat serum, 0.01% Triton X-100) for 1 h, and then incubated with primary antibodies (1:200) at 4 °C overnight. Sections were then washed with PBS 5 times and stained with fluorophore-conjugated secondary antibodies (1:500) at room temperature for 90 min. After washed 5 times, samples were observed with a scanning microscope (Slideview VS200, Olympus, Lake Success, NY, USA).
9
Aorta and Heart Histomorphometry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
F1 and F2 animals were euthanized at the age of 24 weeks, followed by collection of the aorta and heart after heart perfusion. The aorta and heart were embedded in paraffin and serially sectioned at 4-μm thickness for hematoxylin-eosin staining, followed by observation using the SLIDEVIEW VS200 (Olympus, Tokyo, Japan) under 20× conditions. For morphometric analysis of the aorta, the intima-media thickness was detected using OlyVIA V3.3 software (Olympus, Tokyo, Japan).
10
High-Resolution Multicolor Fluorescence Imaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Imaging was performed using a digital slide scanner (Slideview VS200, Olympus, Tokio, Japan) using a LED source (Excelitas Technologies, X-Cite Xylis, Mississauga, Canada). Fluorescence filter cubes and wheels were equipped with a pentafilter (AHF, excitations: 352–404 nm, 460–488 nm, 542–566 nm, 626–644 nm, 721–749 nm; emissions 416–452 nm, 500–530 nm, 579–611 nm, 665–705 nm, 767–849 nm). The images were obtained with a sCMOS camera (2304 × 2304, ORCA-Fusion C14440-20UP, 16 bit, Hamamatsu, Japan), and Olympus universal-plan super apochromat 40× (0.95 NA/air, Olympus). For each slide and cycle imaging in DAPI, FITC, Cy3, Cy5 and Cy7 was performed. Extended focus imaging (EFI) was used to automatically discard unfocused z-stack images, resulting in bright and focused in situ signals.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!