McCoy's 5A medium, RPMI-1640, 100 U/mL streptomycin, 100 μg/mL penicillin and PBS were acquired from gibco (Life Technologies, USA). Fetal bovine serum was obtained from BI (Bioind, Israel). SRB assay kit was obtained from BestBio (Shanghai, China). Cell cycle and apoptosis analysis kits were purchased from Yeasen Biotech (Shanghai, China). Annexin V-FITC/PI apoptosis kit was obtained from Multisciences (Hangzhou, China). Reactive Oxygen Species Assay Kit was obtained from Beyotime (Shanghai, China). Anti-PARP1, anti-caspase 3, anti-GAPDH, anti-GSK3β, anti-p-GSK3β (Ser9), anti-Cyclin D1, anti-β-actin, anti-PI3K, anti-Akt, and anti-p-Akt (Ser473) antibodies were purchased from ProteinTech (Wuhan, China). Anti-cleaved caspase 3 was purchased from Cell Signaling Technology (Beverly, MA, USA). Ultrapure water was produced by the ultrapure water system (Yipu Yida Technology, Nanjing, China). Cisplatin was purchased from Acmec (Shanghai, China). All the analytically pure chemicals and solvents were purchased from Sinopharm Group (Shanghai, China).
Anti parp1
Manufactured by Proteintech
Sourced in China, United States
Anti-PARP1 is a laboratory reagent used to detect the presence of the PARP1 protein in biological samples. PARP1 is a nuclear enzyme involved in various cellular processes, including DNA repair, genomic stability, and cell death. The Anti-PARP1 reagent can be used in techniques such as Western blotting, immunohistochemistry, and immunoprecipitation to study the expression and localization of PARP1 in different cell types and conditions.
Automatically generated - may contain errors
Lab products found in correlation
Anti gapdh, by Proteintech (4 mentions)
Anti grp78, by Proteintech (4 mentions)
Anti perk, by Proteintech (4 mentions)
Anti mtor, by Proteintech (4 mentions)
Anti caspase 3, by Cell Signaling Technology (4 mentions)
Anti par, by Bio-Techne (4 mentions)
Enhanced chemiluminescence detection kit, by Thermo Fisher Scientific (3 mentions)
Anti p mtor, by Santa Cruz Biotechnology (3 mentions)
Anti ire1α, by Proteintech (3 mentions)
Anti atf4, by Proteintech (3 mentions)
Anti kitl, by Biorbyt (3 mentions)
Anti p ire1α, by Biorbyt (3 mentions)
Anti p perk, by Biorbyt (3 mentions)
Anti ha tag, by Yeasen (3 mentions)
Anti flag tag, by Yeasen (3 mentions)
Tanon 4500 gel imaging system, by Thermo Fisher Scientific (3 mentions)
Anti gapdh, by Abcam (3 mentions)
Anti caspase 9, by Cell Signaling Technology (3 mentions)
Anti β actin, by Proteintech (2 mentions)
Anti cyclin d1, by Proteintech (2 mentions)
14 protocols using anti parp1
1
Cytotoxicity and Apoptosis Evaluation
2
Antibodies and Reagents for Cell Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Streptavidin magnetic beads (Cat# 22305‐1) were purchased from Beaverbio (Suzhou, China), Protein A/G agarose beads (Cat# P2108) were obtained from Beyotime Biotechnology (Shanghai, China).
Fetal Bovine Serum (Cat# FND500) was purchased from ExCell Bio (Shanghai, China), SDS‐PAGE Loading Buffer (Cat# WB2001) was purchased from New Cell & Molecular Biotech (Suzhou, China). MLN4924 (Cat# T6332) was obtained from Targetmol (Washington, USA), MG132 (Cat# S2619), and Paclitaxel (Cat# S1150) was obtained from Selleck (Huston, TX, USA).
The anti‐eEF2K antibody (Cat# ab85721, RRID:AB_2 097 314) was obtained from Abcam (Cambridge, UK). Antibodies against GAPDH (Cat# GB11002, RRID:AB_2 904 017), Ki‐67 (Cat# GB111499, RRID:AB_2 927 572) was purchased from Servicebio (Wuhan, China). Antibodies against HA (Cat# 3724, RRID:AB_1 549 585), Myc (Cat# 2278, RRID:AB_490 778), Bcl‐2 (Cat# 15 071, RRID:AB_2 744 528) were purchased from Cell Signaling Technology (Danvers, MA, USA). The anti‐Flag (Cat# M185‐3L, RRID:AB_11 123 930) antibody was obtained from MBL (Japan). Antibodies against N‐Cadherin (Cat# ET1607‐37), Vimentin (Cat# M1412‐1), E‐Cadherin (Cat# ET1607‐75) were purchased from HUABIO (Hangzhou, China). Anti‐PARP1 (Cat# 13371‐1‐AP, RRID:AB_2 160 459) and anti‐Bax (Cat# 50599‐2‐Ig, RRID:AB_2 061 561) antibodies were purchased from Proteintech (Chicago, IL, USA).
Fetal Bovine Serum (Cat# FND500) was purchased from ExCell Bio (Shanghai, China), SDS‐PAGE Loading Buffer (Cat# WB2001) was purchased from New Cell & Molecular Biotech (Suzhou, China). MLN4924 (Cat# T6332) was obtained from Targetmol (Washington, USA), MG132 (Cat# S2619), and Paclitaxel (Cat# S1150) was obtained from Selleck (Huston, TX, USA).
The anti‐eEF2K antibody (Cat# ab85721, RRID:AB_2 097 314) was obtained from Abcam (Cambridge, UK). Antibodies against GAPDH (Cat# GB11002, RRID:AB_2 904 017), Ki‐67 (Cat# GB111499, RRID:AB_2 927 572) was purchased from Servicebio (Wuhan, China). Antibodies against HA (Cat# 3724, RRID:AB_1 549 585), Myc (Cat# 2278, RRID:AB_490 778), Bcl‐2 (Cat# 15 071, RRID:AB_2 744 528) were purchased from Cell Signaling Technology (Danvers, MA, USA). The anti‐Flag (Cat# M185‐3L, RRID:AB_11 123 930) antibody was obtained from MBL (Japan). Antibodies against N‐Cadherin (Cat# ET1607‐37), Vimentin (Cat# M1412‐1), E‐Cadherin (Cat# ET1607‐75) were purchased from HUABIO (Hangzhou, China). Anti‐PARP1 (Cat# 13371‐1‐AP, RRID:AB_2 160 459) and anti‐Bax (Cat# 50599‐2‐Ig, RRID:AB_2 061 561) antibodies were purchased from Proteintech (Chicago, IL, USA).
3
Investigating Cellular Responses with Ruthenium Agents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NaAsO2 was purchased from Sigma-Aldrich (St. Louis, MO). Ruthenium agents were synthesized according to a previous report.33 (link) 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), 4-(2-pyridylazo)resorcinol (PAR) and 2-carboxy-2′-hydroxy-5′-sulfoformazylbenzene sodium salt (Zincon) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). Nitroblue tetrazolium chloride (NBT) and phorbol 12-myristate 13-acetate (PMA) were purchased from Solarbio Science & Technology Co., Ltd. (Beijing, China). RPMI Medium 1640, trypsin–EDTA and fetal bovine serum (FBS) were obtained from Biological Industries (Kibbutz Beit-Haemek, Israel). Anti-PML and anti-CD11b(FITC) antibodies were obtained from Abcam (Cambridge, US). Anti-GAPDH, anti-PARP-1 and anti-caspase-3 antibodies were purchased from Proteintech (Wuhan, China). The apoptosis detection kit and DNA Content Quantitation Assay (Cell Cycle) were purchased from Solarbio Science & Technology Co., Ltd. (Beijing, China). Ultra-purified water was prepared using a Milli-Q Synthesis System (Millipore, Bedford, MA). All other solvents and reagents were used as received.
4
Comprehensive Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total ovary lysates were separated on SDS-PAGE. After electrophoresis, the protein was transferred to PVDF membrane. The membranes were blocked with 5% skimmed milk and incubated with anti-GRP78 (1:1000, #11587–1-AP, Proteintech, Hubei, China), anti-PARP1 (1:4000, #66520-1-lg, Proteintech), anti-PAR (1:1000, #4335-MC-100, Bio-techne, Minneapolis, USA), anti-mTOR (1:1000, #20657-1-AP, Proteintech), anti-p-mTOR (1:800, #sc-293133, Santa cruz, Dallas, Texas, USA), anti-KitL (1:1000, #bs-0545R, Biorbyt, Hubei, China), anti-p-IRE1α (1:800#, bs-16698R, Biorbyt), anti-IRE1α (1:1000, #27528-1-AP, Proteintech), anti-ATF4 (1:1000, #10835-1-AP, Proteintech), anti-p-PERK (1:800, #Orb336657, Biorbyt), anti-PERK (1:1000, #24390-1-AP, Proteintech), anti-HA-tag (1:1000, #30701ES60, YEASEN), anti-FLAG-tag (1:1000, #30501ES60, YEASEN) and anti-GAPDH (1:4000, #ab8245, Abcam, Cambridge, UK) antibodies overnight at 4 °C. After TBST washing, the membranes were treated with the corresponding peroxidase-conjugated secondary antibody, and then the signal was detected with an Enhanced Chemiluminescence Detection Kit (#32106, Thermo Scientific, Waltham, MA, USA) on Tanon 4500 gel imaging system (Shanghai, China).
5
Comprehensive Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total ovary lysates were separated on SDS-PAGE. After electrophoresis, the protein was transferred to PVDF membrane. The membranes were blocked with 5% skimmed milk and incubated with anti-GRP78 (1:1000, #11587–1-AP, Proteintech, Hubei, China), anti-PARP1 (1:4000, #66520-1-lg, Proteintech), anti-PAR (1:1000, #4335-MC-100, Bio-techne, Minneapolis, USA), anti-mTOR (1:1000, #20657-1-AP, Proteintech), anti-p-mTOR (1:800, #sc-293133, Santa cruz, Dallas, Texas, USA), anti-KitL (1:1000, #bs-0545R, Biorbyt, Hubei, China), anti-p-IRE1α (1:800#, bs-16698R, Biorbyt), anti-IRE1α (1:1000, #27528-1-AP, Proteintech), anti-ATF4 (1:1000, #10835-1-AP, Proteintech), anti-p-PERK (1:800, #Orb336657, Biorbyt), anti-PERK (1:1000, #24390-1-AP, Proteintech), anti-HA-tag (1:1000, #30701ES60, YEASEN), anti-FLAG-tag (1:1000, #30501ES60, YEASEN) and anti-GAPDH (1:4000, #ab8245, Abcam, Cambridge, UK) antibodies overnight at 4 °C. After TBST washing, the membranes were treated with the corresponding peroxidase-conjugated secondary antibody, and then the signal was detected with an Enhanced Chemiluminescence Detection Kit (#32106, Thermo Scientific, Waltham, MA, USA) on Tanon 4500 gel imaging system (Shanghai, China).
6
Western Blot Antibody Screening Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot assays were conducted as previously described.8 The associated primary immunoblotting antibodies were as follows: anti‐GAPDH, anti–E‐cadherin, anti–N‐cadherin, anti‐Vimentin, anti‐CDK6, anti‐CCND1, anti‐CDK4, anti‐NOP14, anti‐MMP9, anti‐MMP2, anti‐E2F1, anti‐MET, anti‐Parp‐1, (Proteintech Group), anti‐Caspase 3, anti‐DNMT3B (Cell Signaling Technology) and anti‐SP1 (Santa Cruz Biotechnology).
7
Comprehensive Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total ovary lysates were separated on SDS-PAGE. After electrophoresis, the protein was transferred to PVDF membrane. The membranes were blocked with 5% skimmed milk and incubated with anti-GRP78 (1:1000, #11587–1-AP, Proteintech, Hubei, China), anti-PARP1 (1:4000, #66520-1-lg, Proteintech), anti-PAR (1:1000, #4335-MC-100, Bio-techne, Minneapolis, USA), anti-mTOR (1:1000, #20657-1-AP, Proteintech), anti-p-mTOR (1:800, #sc-293133, Santa cruz, Dallas, Texas, USA), anti-KitL (1:1000, #bs-0545R, Biorbyt, Hubei, China), anti-p-IRE1α (1:800#, bs-16698R, Biorbyt), anti-IRE1α (1:1000, #27528-1-AP, Proteintech), anti-ATF4 (1:1000, #10835-1-AP, Proteintech), anti-p-PERK (1:800, #Orb336657, Biorbyt), anti-PERK (1:1000, #24390-1-AP, Proteintech), anti-HA-tag (1:1000, #30701ES60, YEASEN), anti-FLAG-tag (1:1000, #30501ES60, YEASEN) and anti-GAPDH (1:4000, #ab8245, Abcam, Cambridge, UK) antibodies overnight at 4 °C. After TBST washing, the membranes were treated with the corresponding peroxidase-conjugated secondary antibody, and then the signal was detected with an Enhanced Chemiluminescence Detection Kit (#32106, Thermo Scientific, Waltham, MA, USA) on Tanon 4500 gel imaging system (Shanghai, China).
8
Evaluating Neurodegenerative Disease Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EGFP‐TFEB WT (38,119), mRFP‐GFP‐LC3B (84,573), EGFP‐α‐synucleinA53T (40,823), and PHM‐α‐synucleinA53T (40,825) were supplied by Addgene. GFP‐Adenovirus (AdV) and A53T‐AdV were purchased from Obio Technology. Corp. Ltd. anti‐α‐synuclein (10842‐1‐AP), anti‐PARP1 (13371‐1‐AP), anti‐TFEB (13372‐1‐AP), anti‐m‐TOR (20657‐1‐AP), anti‐LAMP1 (21997‐1‐AP), and anti‐Lamin B (12987‐1‐AP) were purchased from Proteintech; anti‐p‐m‐TOR (#5536), anti‐SIRT1 (#8469), anti‐β‐ACTB (#4970), anti‐LC3B A/B (#4211), and anti‐PGC‐1α (#2178s) were purchased from CST; anti‐TH (Santa, sc‐25269); anti‐γ‐H2A.X (Abcam, ab243906); anti‐PAR (Trevigen,4335‐MC‐100); Veliparib (Selleck, s1004); Veliparib (TargetMol; T2591); SRT2104 (Selleck, s7792); EX527(Selleck, s1541); CQ (Selleck, s8808); rapamycin (MedChenExpress, HY‐10219); and KPT‐330 (Selleck, s725).
Primers:
ACTB: F‐CATTGCTGACAGGATGCAGAAGG‐, R‐TGCTGGAAGGTGGACAGTGAGG‐
LC3B: F‐GGACCTGCTGCTTCTCTAA‐, R‐ACTGCTGAGTGAAAGGGTGT‐
LAMP1: F‐AGCCCTGGAATTGCAGTTTG‐, R‐CACTGTCCACCTTGAAAGCC‐
α‐synucleinA53T‐tg: F‐TGTAGGCTCCAAAACCAAGG‐, R‐TGTCAGGATCCACAGGCATA‐
siPARP1: F‐GCAGCGAGUAGUAUUCCCAAdTdT‐, R‐UUGGGAAUACUCUCGCUGCdTdT‐;
siSIRT1: F‐ACGAUGACAGAACGUCACAdTdT‐, R‐UGUGAGUUCUGUCAUCGUdTdT‐
Primers:
ACTB: F‐CATTGCTGACAGGATGCAGAAGG‐, R‐TGCTGGAAGGTGGACAGTGAGG‐
LC3B: F‐GGACCTGCTGCTTCTCTAA‐, R‐ACTGCTGAGTGAAAGGGTGT‐
LAMP1: F‐AGCCCTGGAATTGCAGTTTG‐, R‐CACTGTCCACCTTGAAAGCC‐
α‐synucleinA53T‐tg: F‐TGTAGGCTCCAAAACCAAGG‐, R‐TGTCAGGATCCACAGGCATA‐
siPARP1: F‐GCAGCGAGUAGUAUUCCCAAdTdT‐, R‐UUGGGAAUACUCUCGCUGCdTdT‐;
siSIRT1: F‐ACGAUGACAGAACGUCACAdTdT‐, R‐UGUGAGUUCUGUCAUCGUdTdT‐
9
Western Blot Analysis of Cellular Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following primary antibodies were used for Western blot analysis: rabbit polyclonal anti-PARP1(1:1000) (Proteintech, Rosemont, IL, USA, #13371-1), rabbit polyclonal anti-phospho STAT3 Tyr705 (1:500) (Santa Cruz Biotechnology, Inc. Heidelberg, Germany, #sc-8059), mouse monoclonal anti-STAT3 (1:100) (BD Transduction Lab, Franklin Lakes, NJ, USA, #610189), rabbit polyclonal anti-LC3I/II (1:1000) (Novus, CO, USA, #NB100-2220), mouse monoclonal anti-p62/SQSTM1 (1:300) (BD Transduction Lab, #610832), rabbit polyclonal anti-XBP1 (1:1000) (NovusBio, #NBP1-77681SS), rabbit polyclonal anti-ATF6 (1:200) (Cell Signaling Technology, Danvers, MA, USA, #65880), rabbit polyclonal anti-phospho eIF2α (Ser15) (1:200) (Cell Signaling, #3398), rabbit polyclonal anti-eIF2α (1:500) (Cell Signaling, #9722), mouse monoclonal anti-β-actin (1:10000) (Sigma Aldrich, #A5441) and anti hsp70 (Santa Cruz Biotechnology, Inc. Heidelberg, Germany, #sc-32239) were used as loading control. Goat anti-rabbit IgG-horseradish peroxidase HRP (1:10000) (Santa Cruz Biotechnology, Inc. Heidelberg, Germany, sc-2004), goat anti-mouse IgG-horseradish peroxidase HRP (1:10000) (Santa Cruz Biotechnology, Inc. Heidelberg, Germany, sc-2005) were used as secondary antibodies. All primary and secondary antibodies used in this study were diluted in a PBS-0.2% Tween 20 solution containing 3% BSA.
10
Western Blotting with Diverse Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blotting was carried out as described previously 15 (link), 21 (link), 22 (link). Anti-Bcl-2, anti-Mcl-1, anti-PARP1, anti-cytochrome C, anti-ERK, anti-p-ERK, anti-Bim, anti-TSHR, anti-HK2, anti-Bax, anti-cyclin D1, and anti-GAPDH antibodies were purchased from ProteinTech (Chicago, IL, USA); anti-GLUT1 (NB110-39113SS) antibody was acquired from Novusbio. Anti-Beclin1 (#3738), anti-p62 (#8025), anti-p27 Kip1 (#3688), anti-Bcl-xl (#2764), anti-LC3A/B (#12741), anti-Caspase-3 (#9662), anti- Caspase-9 (#9502), anti-Caspase-8 (#9746) antibodies were purchased from Cell Signaling Technology. For immunoprecipitation, cells were treated for 24 hours with Vemurafenib before harvesting. NP40 lysates and BRAF immunoprecipitates were prepared according to the previous publication using rabbit anti-BRAF antibody (Santa Cruz Biotechnology, sc-5284) and analyzed by immunoblot using mouse anti-CRAF antibody (Santa Cruz Biotechnology, sc-227) or inversely 23 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!