The following markers were used for live imaging: endo-DE-cadherin:GFP (Huang et al., 2009 (link)), ubi-DE-cadherin:GFP (Oda and Tsukita, 2001 (link)), UAS-DE-cadherin:GFP (gift of N. Gorfinkiel, Consejo Superior de Investigaciones Cientificas–Universidad Autónoma de Madrid, Madrid, Spain), UAS-p120-catenin:GFP (Bloomington Drosophila Stock Center; Myster et al., 2003 (link)), UAS-actin:RFP (Simões et al., 2006 (link); gift of N. Gorfinkiel), sqh-GFP:moesin (Kiehart et al., 2000 (link)), UAS-mCherry:moesin (Millard and Martin, 2008 (link)), sqh-sqh:GFP (Royou et al., 2004 (link)), sqh-sqh:mCherry (Martin et al., 2009 (link)), sqh-GFP:rokK116A (Simões et al., 2010 (link)), UAS-GFP:clc (Chang et al., 2002 (link)), 20XUAS-shits1:GFP (Pfeiffer et al., 2012 (link)), UAS-Apoliner (Bloomington Drosophila Stock Center; Bardet et al., 2008 (link)), UAS-GFP (gift of U. Tepass, University of Toronto, Toronto, Canada), 10XUAS-myr:GFP (Bloomington Drosophila Stock Center; Pfeiffer et al., 2010 (link)), UAS-GCaMP3 (Bloomington Drosophila Stock Center; Tian et al., 2009 (link)), and UAS-arf6:GFP (this study). daughterless-Gal4 or tubulin-Gal4 (Bloomington Drosophila Stock Center) were used to drive ubiquitous expression of all UAS transgenes. tubulin-Gal4 was used for all overexpression experiments. yellow white flies were used for controls.
Daughterless gal4
Manufactured by Bloomington Drosophila Stock Center
Sourced in United States
The Daughterless-Gal4 is a genetic tool used in Drosophila research. It is a Gal4 driver line that expresses the Gal4 transcriptional activator under the control of the daughterless (da) promoter, which drives ubiquitous expression throughout the organism's development.
Automatically generated - may contain errors
Lab products found in correlation
W1118, by Bloomington Drosophila Stock Center (3 mentions)
Nsyb gal4, by Bloomington Drosophila Stock Center (2 mentions)
Uas gcamp3, by Bloomington Drosophila Stock Center (1 mentions)
Uas apoliner, by Bloomington Drosophila Stock Center (1 mentions)
Tubulin gal4, by Bloomington Drosophila Stock Center (1 mentions)
Cg gal4, by Bloomington Drosophila Stock Center (1 mentions)
Ppl gal4, by Bloomington Drosophila Stock Center (1 mentions)
Dj gfp, by Bloomington Drosophila Stock Center (1 mentions)
Uas gcamp6m, by Bloomington Drosophila Stock Center (1 mentions)
Acetazolamide, by Merck Group (1 mentions)
Uas gfp, by Bloomington Drosophila Stock Center (1 mentions)
Lansoprazole, by Takeda Pharmaceuticals (1 mentions)
Uas cas9, by Bloomington Drosophila Stock Center (1 mentions)
Nanos gal4, by Bloomington Drosophila Stock Center (1 mentions)
Elav gal4, by Bloomington Drosophila Stock Center (1 mentions)
Canton s, by Bloomington Drosophila Stock Center (1 mentions)
Oregonr c, by Bloomington Drosophila Stock Center (1 mentions)
Da gal4, by Bloomington Drosophila Stock Center (1 mentions)
7 protocols using daughterless gal4
1
Live Imaging of Drosophila Cell Junctions and Dynamics
2
Transgenic Drosophila Pif1A Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flies were reared on standard cornmeal medium at 25 ℃. The following strains were used: w1118, tubublin-Gal4, daughterless-Gal4,Cg-Gal4, ppl-Gal4,β2tubulin-GFP; Bloomington Drosophila Stock Center Df(3R)BSC478/TM6(BL24982), Dj-GFP (BL5417), Pif1A-GFP.FPTB/Cyo(BL42670), Dj-GFP(BL5417), protamine B-eGFP/Cyo(BL58406); bam-Gal4 and tj-Gal4 (kindly provided by Chao Tong); nos-Gal4 and UAS-actin.GFP/CyO; Sb/TM6B (Tsinghua Fly Center).
To generate the Pif1A mutants, we employed the “CRISPR/Cas9 method”, the gRNA was designed to recognize a 19-nt target sequence and act to direct Cas9-mediated cleavage of both DNA strands within the target site.
To generate UAS-Pif1A-RI, UAS-Pif1A-RG, and UAS-eGFP-Pif1A-RG transgenenic flies, we amplified the full length Pif1A cDNA with the primers below and cloned it into the pUAST-attb vector. These constructs were then transformed into VK33 embryos using the standard P-element-mediated transgenesis protocol.
Pif1A- RG-FCTGCGGCCGCGGCTCGAGATGGCTGAAAACCAAACCAAAACG
Pif1A- RG-RTCACAAAGATCCTCTAGATCAGAGCCGGGCATTCTCGGACGG
Pif1A- RI-FCTGCGGCCGCGGCTCGAGATGGGCAACGAGGAATCCT
Pif1A- RI-RTCACAAAGATCCTCTAGACTATTTCTTAGCTCTGAACAAG
eGFP-Pif1A- RG-F TTCGTTAACAGATCTGCATGGTGAGCAAGGGCGAGGA
eGFP-Pif1A- RG-R ATCTCGAGCCGCGGCCGCCACTTGTACAGCTCGTCCATG
To generate the Pif1A mutants, we employed the “CRISPR/Cas9 method”, the gRNA was designed to recognize a 19-nt target sequence and act to direct Cas9-mediated cleavage of both DNA strands within the target site.
To generate UAS-Pif1A-RI, UAS-Pif1A-RG, and UAS-eGFP-Pif1A-RG transgenenic flies, we amplified the full length Pif1A cDNA with the primers below and cloned it into the pUAST-attb vector. These constructs were then transformed into VK33 embryos using the standard P-element-mediated transgenesis protocol.
Pif1A- RG-FCTGCGGCCGCGGCTCGAGATGGCTGAAAACCAAACCAAAACG
Pif1A- RG-RTCACAAAGATCCTCTAGATCAGAGCCGGGCATTCTCGGACGG
Pif1A- RI-FCTGCGGCCGCGGCTCGAGATGGGCAACGAGGAATCCT
Pif1A- RI-RTCACAAAGATCCTCTAGACTATTTCTTAGCTCTGAACAAG
eGFP-Pif1A- RG-F TTCGTTAACAGATCTGCATGGTGAGCAAGGGCGAGGA
eGFP-Pif1A- RG-R ATCTCGAGCCGCGGCCGCCACTTGTACAGCTCGTCCATG
3
Drosophila Genetic Stocks for Wnt Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following stocks were used in this study: wgCX4 b1 pr1/CyO (#2980), Wnt4C1/CyO (#6651), Wnt2L/CyO (#6909), Wnt5Gal4 (#59034), Df(1)N19/FM6 (#970), Df(2L)ED729/SM6a (#24134) daughterless::Gal4 (#5460) (Bloomington Drosophila Stock Center, Bloomington, USA; stock numbers given in parentheses). P(GSV3)GS8107 (#201394, Kyoto Drosophila Stock Center); fzJ22, fzP21 (gifts from Paul Adler, University of Virginia, Charlottesville, USA), fzR52 (gift from Ken Cadigan, University of Michigan, Ann Arbor, USA); fz2C2 (gift from G. Struhl, Columbia University, New York City, USA); Df(3L)469-2 (Bhanot et al., 1999 (link)); Wnt5400 (Fradkin et al., 2004 (link)); otkA1, otk2C26, Df(otk,otk2)D72 (Linnemannstöns et al., 2014 (link)); Transgenic fly lines for the constructs UAS::Ror-Myc and Ror::Ror-eGFP were generated as described (Bischof et al., 2007 (link); Fish et al., 2007 (link)).
4
Generating Membrin Null Flies for Neuroscience
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
membrin1,524 flies were previously generated in an ethyl methanesulfonate (EMS) screen and kindly shared by Mark Krasnow (Ghabrial et al., 2011 (link)). This strain harbors a premature stop codon upstream of the membrin SNARE domain encoding sequence and therefore represents a null allele. To control for potential genetic background effects, we outcrossed membrin1,524 for five generations into an isogenic iso31 background by following an AccI (NEB) restriction site that is introduced by the nonsense mutation. daughterless-Gal4 (#55850), UAS-GCaMP6m (#42748), and nsyb-Gal4 (#51635) flies were obtained from the Bloomington Stock Center, and the membrin RNAi transgene was obtained from the Vienna Drosophila Resource Center (VDRC) (GD 44535) (Dietzl et al., 2007 (link)). These transgenes and alleles were backcrossed for 5 generations into an isogenic iso31 background. Backcrossed elav-Gal4 flies were a kind gift from Kyunghee Koh. Flies were reared on a standard cornmeal-molasses-yeast medium at 25°C in a 12-hr light/dark cycle. See Supplemental Experimental Procedures for further details.
5
Drosophila Lifespan Assay with Pharmacological Agents
Check if the same lab product or an alternative is used in the 5 most similar protocols
w1118, EP2372, P[Δ2–3], P112087, Cyo/sp;TM3,Ser/TM6, Cop-Gal4 (NP3270), daughterless-Gal4 and UAS-GFP fly stocks were obtained from the Bloomington Drosophila Stock Center. UAS-vha16-1 was generated from a full-length vha16-1 cDNA and subcloned into the pUAST vector as previously described [12 (link)]. All flies were raised on standard sucrose/yeast/cornmeal food and were backcrossed into the w1118 background for at least 5 generations, as described previously [13 (link)]. For the life span assays, flies that had eclosed within 48 hours (approximately 100 males and 100 females) were transferred to a 1-liter population cage and maintained in a humidified, temperature-controlled incubator with 12-hour on/off light cycle at 25°C [14 (link)]. Fresh food was provided every other day, and the number and sex of dead flies were scored. Fly food contained 5% dextrose, 5% yeast, 2% agar, and 0.23% Tegosept (Apex). 500uM lansoprazole (Takeda Pharmaceuticals Taiwan), acetazolamide (Sigma) or vehicle control was added to the foods described in the experiment.
+ Expand
w1118, EP2372, P[Δ2–3], P112087, Cyo/sp;TM3,Ser/TM6, Cop-Gal4 (NP3270), daughterless-Gal4 and UAS-GFP fly stocks were obtained from the Bloomington Drosophila Stock Center. UAS-vha16-1 was generated from a full-length vha16-1 cDNA and subcloned into the pUAST vector as previously described [12 (link)]. All flies were raised on standard sucrose/yeast/cornmeal food and were backcrossed into the w1118 background for at least 5 generations, as described previously [13 (link)]. For the life span assays, flies that had eclosed within 48 hours (approximately 100 males and 100 females) were transferred to a 1-liter population cage and maintained in a humidified, temperature-controlled incubator with 12-hour on/off light cycle at 25°C [14 (link)]. Fresh food was provided every other day, and the number and sex of dead flies were scored. Fly food contained 5% dextrose, 5% yeast, 2% agar, and 0.23% Tegosept (Apex). 500uM lansoprazole (Takeda Pharmaceuticals Taiwan), acetazolamide (Sigma) or vehicle control was added to the foods described in the experiment.
6
Drosophila Huntington's Disease Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fly stocks were maintained at room temperature following standard culture conditions. All fly crosses were performed at 25°C following standard genetic procedure unless otherwise specified. The following fly lines were from Bloomington Drosophila Stock Center: UAS-Htt.128Q.FL (#33808), UAS-Htt.16Q.FL (#33810), UAS-cas9 (58985), elav-Gal4 (#458), daughterless-Gal4 (#55850), nSyb-Gal4 (#51635), nanos-Gal4 (#4442).
UAS-Htt93Q-exon1 is a gift from Dr. Leslie Thompson.
UAS-Htt93Q-exon1 is a gift from Dr. Leslie Thompson.
7
Drosophila Genetic Stock Maintenance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flies were obtained from the Bloomington Drosophila Stock Center (Indiana University) and maintained in the laboratory at room temperature on standard cornmeal medium. The following fly stocks were used: w 1118 (Bloomington stock 3605), Daughterless-GAL4 (Da-GAL4; Bloomington stock 8641), Oregon-R-C (Bloomington stock 5), Canton-S (Bloomington stock 64349), TM3/Et 50 (Bloomington stock 64349), TM3/Sb (Bloomington stock 4534), CyO/Sp 1 (Bloomington stock 4199), and the Nopp140 gene deletion line, KO121 (He et al. 2015) (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!