Superreal premix plus sybr green mixture

The miRNA was extracted from MCF‐7 cells with the miRcute miRNA isolation kit (DP501, Tiangen, Beijing, China). Total RNA was extracted from transfected MCF‐7 cells with the total RNA rapid extraction kit (220010, Feijie Biological, Shanghai, China). After quality control, the FastQuant RT kit (KR106, Tiangen, Beijing, China) was used to reverse transcribe the miRNA or RNA sample into complementary DNA (cDNA). qRT‐PCR was performed in an ABI 7300 real‐time PCR system (Applied Biosystems, Foster City, CA, USA). SuperReal PreMix Plus (SYBR Green) mixture (FP205; Tiangen) was applied for reactions. The relative amounts of miR‐363‐5p to control U6 and platelet‐derived growth factor B (PDGFB) to control GAPDH transcripts were analyzed by the 2^−ΔΔCt method. Primers applied were listed as follows: miR‐363‐5p: forward: 5′‐CGGGTGGATCACGATG‐3′; reverse: 5′‐CAGTGCAGGGTCCGAGGTAT‐3′; U6: forward: 5′‐CTCGCTTCGGCAGCACA‐3′; reverse: 5′‐AACGCTTCACGAATTTGCGT‐3′ [28 (link)].