Fluorescein isothiocyanate fitc conjugated avidin

Karyotypes were determined from G-banding analysis using standard protocol according to the ISCN nomenclature. FISH analysis was carried out using protocols as described elsewhere. [54] (link), [55] (link) Metaphase chromosomes were prepared from Epstein-Barr virus-transformed lymphoblastoid cell lines (EBV-LCL) or cultured skin fibroblast cells obtained from patients, parents or siblings carriers by standard techniques. BAC and fosmid probes were obtained from BACPAC Resources (Oakland, CA). Probes were labelled by nick-translation kit (Enzo) with biotin-16-dUTP or digoxigenin-11-dUTP (Roche). The probes were blocked with 1 µg/µl Cot-1 DNA (Life Technologies), and resuspended at a concentration of 5 ng/µl in hybridization buffer (2xSSC, 10% Dextran Sulfate, 1x PBS, 50% Formamide). Fluorescent signals were visualized by avidin-conjugated fluorescein isothiocyanate (FITC) (Vector Laboratories, CA) or anti-Digoxigenin-Rhodamine (Roche). Chromosomes were counter-stained with DAPI and the signal was analysed using a Nikon Epifluorescence Microscope equipped with ISIS Metasystems for imaging analysis.

Dulbecco’s modified Eagle medium (DMEM), Ham’s F12 medium, and High Capacity RNA-to-cDNA kit were purchased from Life Technologies (Grand Island, NY, USA). Realtime PCR master mix was from Takara (Tokyo, Japan). Anti-vimentin polyclonal antibodies was from ImmunoResearch Laboratories (Grove, PA, USA). Anti-E-cadherin monoclonal antibody was from Santa Cruz (G-10, Santa Cruz, CA, USA) Avidin-conjugated fluorescein isothiocyanate (FITC) was from Vector Laboratories (Burlingame, CA, USA), and N102 blocking reagent was from NOF Corporation (Tokyo, Japan). Fetal bovine serum (FBS) was from Hyclone (South Logan, UT, USA). DC protein assay kits (based on the Lowry method) were from Bio-Rad Laboratories (Hercules, CA, USA), and Isogen RNA extraction kits were from Nippon Gene (Tokyo, Japan). Transwell chambers with 8 μm pores were from BD Bioscience (Franklin Lakes, NJ, USA). Matrigel® was from Corning (Tewksbury, MA, USA).

The FISH procedure followed that described in Lee et al. [70 (link)]. The SatA probe was designed from a conserved region of the SatA monomer alignment and labeled with digoxigenin using oligonucleotide-5′-end-labeling (AAATCTGACCTAATTTGGACCCAATCTTTGAACCTTCTAATTGAAGGTCAATTGGTGT). Probes for 45S rDNA (pTA71 containing a repetitive unit of 45S rDNA from Triticum aestivum) [71 (link)] and 5S rDNA (pTA794 containing the 5S rDNA repeat unit from T. aestivum) [72 (link)] were also used. The rDNA sequences were labeled by nick translation with digoxigenin-11-dUTP orbiotin-16-dUTP (Roche Diagnostics GmbH, Penzberg, Germany). Digoxigenin-labeled probes were detected by anti-digoxigenin-rhodamine (Roche Diagnostics GmbH), whereas biotin-labeled probes were detected using fluorescein isothiocyanate (FITC)-conjugated avidin (Vector Laboratories, Burlingame, CA, USA). Chromosomes were counterstained with 4′, 6-diamidino-2-phenylindole (DAPI) in an anti-fade solution (Vector Laboratories, CA, USA). All images were captured digitally using a CCD camera attached to an epifluorescence microscope (Axioskop 2, Carl Zeiss AG, Germany). The CCD camera was controlled by Image-Pro Plus software (version 4.5.1, Media Cybernetics, Yorktown, VA, USA), and final image adjustments were made with Adobe Photoshop CS2 (version 9.0.2, Adobe Systems Inc., San Jose, CA, USA).