Pcr fluorescein labeling mix

Manufactured by Roche

Sourced in Switzerland

The PCR Fluorescein Labeling Mix is a reagent used in the polymerase chain reaction (PCR) process. It contains the necessary components, including fluorescein, for labeling amplified DNA segments during the PCR amplification step.

Automatically generated - may contain errors

Lab products found in correlation

Pcr2.1 vector, by Thermo Fisher Scientific (1 mentions) Qiaquick gel extraction kit, by Qiagen (1 mentions) High fidelity dna polymerase, by Takara Bio (1 mentions) Fluoview 1000 confocal microscope, by Olympus (1 mentions) Fish hybridization solution, by Dingguo (1 mentions)

4 protocols using pcr fluorescein labeling mix

Mouse Major Satellite DNA FISH

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse brain sections (5um) on glass slides were de-paraffined and incubated in 10mM citric acid buffer at 95C for 30min. The slides were washed three times with PBS, treated with 0.1% Triton X100 in PBS for 15min and followed by two 2XSSC washes, a cold acetone treatment for 5 min, and three more 2X SSC washes for 5 min each at room temperature. Then the slides were treated or stored in 2XSSC and 50% formamide for longer than 4 hours.
The FISH probe for mouse major satellite DNA was amplified from the plasmid clone pγSat that contains eight copies of the 234bp mouse major satellite (γ-satellite) repeats using PCR Fluorescein Labeling Mix (Roche). Oligo primers used for PCR amplification are CGTGATTTTCAGTTTTCTCG and GGCGAGGAAAACTGAAAAAG. Pretreated tissue slides were transferred to hybridization buffer containing 50% formamide, 20mM sodium phosphate pH7.0 and 2xSSC, co-denatured with 100ng of DNA probe per slide at 80°C for 5 minutes, followed by hybridization at 37°C for 48–72 hours. After hybridization, slides were washed three time with 2XSSC at 37°C for 5 min, three times with 0.1XSSC and 0.1% NP-40 at 60°C for 5 min, and once with 2XSSC at room temperature for 5 min. Then the slides were transferred to PBS and processed for immuno-histological stains.

Chomiak A.A., Guo Y., Kopsidas C.A., McDaniel D.P., Lowe C.C., Pan H., Zhou X., Zhou Q., Doughty M.L, & Feng Y. (2022). Nde1 is required for heterochromatin compaction and stability in neocortical neurons. iScience, 25(6), 104354.

+ Open protocol

+ Expand

Fluorescein-Labeled Centromeric Repeat Probe

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR primers JC103 (5’GGTGCTAGATTTAGGAAAACA 3’) and JC106 (5’GTGCATTCATGACTTTTAAGG 3’) were used to amplify the threespine stickleback centromeric repeat from genomic DNA. The PCR product appeared as a ladder. The entire ladder was extracted using the QIAquick gel extraction kit (Qiagen, USA). The purified PCR product was cloned into the PCR2.1 vector (Life Technologies, USA). The clone used as a template to make the FISH probe contained 1.5 copies of the centromeric repeat. This clone was amplified using primers JC103 and JC106 with PCR fluorescein labeling mix (Roche Applied Science, Switzerland) to make a fluorescein-12-dUTP labeled probe of 288 bp. The probe was lyophilized at 55°C for 3 hours, then resuspended in 10 μl hybridization buffer (50% formamide, 2X saline-sodium citrate (SSC), 10% dextran sulfate, 0.2 mM Ethylenediaminetetraacetic acid (EDTA), 2 mM Tris pH 8.0). The probe was denatured at 72°C for 5 min and then stored at 37°C until use.

Cech J.N, & Peichel C.L. (2015). Identification of the centromeric repeat in the threespine stickleback fish (Gasterosteus aculeatus). Chromosome research : an international journal on the molecular, supramolecular and evolutionary aspects of chromosome biology, 23(4), 767-779.

+ Open protocol

+ Expand

Visualizing lncTCF7 expression in DLD1 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

A fragment of a 550-bp lncTCF7 cDNA was amplified from the lncTCF7 plasmid by using a high-fidelity DNA polymerase (Takara) as the DNA template. From this template, a fluorescein-labeled DNA as the lncTCF7 FISH probe was made with PCR Fluorescein Labeling Mix (Roche, Basel, Switzerland). DLD1 cells were cultured on slides treated with or without 100 nM 1,25(OH)2D3 for 48 h. The slide was soaked in proteinase K for 5 min and washed in 2× SSC twice. A FISH hybridization solution (Dingguochangsheng, Beijing, P.R. China) containing 30 ng/μl lncTCF7 FISH probe DNA was applied to the slide, which was subsequently incubated at 37°C for 16 h. The slide was then washed in 0.4× SSC/0.001% NP-40 at 560°C for 5 min followed by a second wash in 2× SSC/0.0001% NP-40 for another 2 min. The slide was covered with a drop of mounting medium containing DAPI and visualized using a Fluoview 1000 confocal microscope (Olympus).

Li T., Zhu J., Zuo S., Chen S., Ma J., Ma Y., Guo S., Wang P, & Liu Y. (2019). 1,25(OH)2D3 Attenuates IL-1β-Induced Epithelial-to-Mesenchymal Transition Through Inhibiting the Expression of lncTCF7. Oncology Research, 27(7), 739-750.

+ Open protocol

+ Expand

FISH Analysis of Mouse Major Satellite DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse brain sections (5um) on glass slides were de-paraffined and incubated in 10mM citric acid buffer at 95C for 30min. The slides were washed three times with PBS, treated with 0.1% Triton X100 in PBS for 15min and followed by two 2XSSC washes, a cold acetone treatment for 5 min, and three more 2X SSC washes for 5 min each at room temperature. Then the slides were treated or stored in 2XSSC and 50% formamide for longer than 4 hours.
The FISH probe for mouse major satellite DNA was amplified from the plasmid clone pγSat that contains eight copies of the 234bp mouse major satellite (γ-satellite) repeats using PCR Fluorescein Labeling Mix (Roche). Oligo primers used for PCR amplification are GACGACTTGAAAAATGACGAAATC, and CATATTCCAGGTCCTTCAGTGTGC. Pretreated tissue slides were transferred to hybridization buffer containing 50% formamide, 20mM sodium phosphate pH7.0 and 2xSSC, co-denatured with 100ng of DNA probe per slide at 80°C for 5 minutes, followed by hybridization at 37°C for 48-72 hours. After hybridization, slides were washed three time with 2XSSC at 37°C for 5 min, three times with 0.1XSSC and 0.1% NP-40 at 60°C for 5 min, and once with 2XSSC at room temperature for 5 min. Then the slides were transferred to PBS and processed for immuno-histological stains.

Chomiak A.A., Lowe C.C., Guo Y., McDaniel D.P., Pan H., Zhou X., Zhou Q., Doughty M.L., & Feng Y. (2021). Nde1 is Required for Heterochromatin Compaction and Stability in Neocortical Neurons.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!