Log In Sign up
The largest database of trusted experimental protocols

Agencourt ampure xp

Manufactured by Beckman Coulter
Visit Supplier
Sourced in United States, Canada, Germany, China, Japan

Agencourt AMPure XP is a magnetic bead-based purification system used for the purification of DNA, RNA, and other biomolecules. The product utilizes paramagnetic beads to selectively bind and capture target molecules, allowing for efficient removal of unwanted contaminants and salts.

Automatically generated - may contain errors

Lab products found in correlation

Miseq platform, by Illumina (38 mentions) Qubit dsdna hs assay kit, by Thermo Fisher Scientific (29 mentions) Qubit 2.0 fluorometer, by Thermo Fisher Scientific (22 mentions) Agilent 2100 bioanalyzer, by Agilent Technologies (16 mentions) Kapa hifi hotstart readymix, by Roche (15 mentions) Hiseq 2500, by Illumina (14 mentions) 2100 bioanalyzer, by Agilent Technologies (13 mentions) Minelute pcr purification kit, by Qiagen (12 mentions) Miseq system, by Illumina (12 mentions) Miseq reagent kit v3, by Illumina (11 mentions) Nextera xt dna library preparation kit, by Illumina (10 mentions) Hiseq 2000, by Illumina (9 mentions) Miseq reagent kit v2, by Illumina (9 mentions) Rneasy mini kit, by Qiagen (9 mentions) Nextera xt index kit, by Illumina (8 mentions) Tagment dna enzyme, by Illumina (8 mentions) Agilent high sensitivity dna kit, by Agilent Technologies (8 mentions) Nanodrop 2000, by Thermo Fisher Scientific (8 mentions) Nanodrop, by Thermo Fisher Scientific (8 mentions) Qubit fluorometer, by Thermo Fisher Scientific (8 mentions)

Close spelling variants of this product

Agencourt AMPure Beads XP Agencourt AMPure XP SPRI magnetic beads Agencourt AMPure XP DNA purification beads Agencourt AMPure XP bead-purification Agencourt AMPure XP beads kit Agencourt AMPure XP SPRI beads Agencourt AMPure XP magnetic beads Agencourt® AMPure® XP Kit for DNA purification Agencourt AMPure XP PCR Purification Beads Agencourt AMPure XP Bead clean-up

374 protocols using agencourt ampure xp

1

Genotyping of Recombinant Inbred Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Leaf samples were collected from the 275 RILs in the F7 generation. Leaf tissues were used to extract total genomic DNA using the CTAB method. The quantity and quality of genomic DNA was determined by NanoDrop ND-1000 Spectrophotometer and 1% agarose gel electrophoresis, respectively (Thermo Scientific, Wilmington, USA).
For 275 RILs, the genomic DNA was incubated with ATP (NEB), T4 DNA ligase (NEB), MseI (New England Biolabs, NEB), and MseI Y adapter N containing barcode at 37°C. Temperature at 65°C was used to inactivate restriction ligation reactions and digested at 37°C by the additional restriction enzyme (NlaIII). Agencourt AMPure XP (Beckman) was utilized to purify samples of the restriction ligation. Finally PCR was done with these purified samples, universal primers of Phusion Master Mix (NEB), index primers to add index, as well as entire i5 and i7 sequences. Purification of products of PCR was carried out by Agencourt AMPure XP (Beckman) then pooled and run on an agarose gel (2%). Gel extraction kit (Qiagen) was utilized to separate fragments of 375-400 bp (with indexes and adaptors) in size. The fragment products were subsequently purified by using Agencourt AMPure XP (Beckman) and diluted to further sequencing. After that paired-end sequencing was done on the selected tags with Illumina HiSeq PE150 platform (Novogene Bioinformatics Technology Co., Ltd, P.R. China).
Yang J., Wei J., Xu J., Xiong Y., Deng G., Liu J., Fahad S, & Wang H. (2022). Mapping QTLs for anaerobic tolerance at germination and bud stages using new high density genetic map of rice. Frontiers in Plant Science, 13, 985080.
+ Open protocol
+ Expand
2

GBS Library Construction and Sequencing

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The GBS library was constructed according to standard GBS protocol [28 (link), 29 (link)]. DNA of each individual of the F2 population and parents was prepared by restriction digestion with MseI and HaeIII, followed by ligation with barcoded adapters for individual labeling. The restriction ligation samples with different barcode sequences were purified with Agencourt AMPure XP (Beckman). PCR was then performed using purified samples with Phusion Master Mix (NEB) universal primer and index primers for amplification of the complete i5 and i7 sequences. The PCR products were purified using Agencourt AMPure XP (Beckman) and pooled, and then run on a 2% agarose gel. Fragments of 375–400 bp (including indexes and adaptors) were isolated using a gel extraction kit (Qiagen). These fragment products were then purified using Agencourt AMPure XP (Beckman), and used for pair-end sequencing with the Illumina HiSeq™ 2500 platform.
Yang Z., Yang Y., Dai Z., Xie D., Tang Q., Cheng C., Xu Y., Liu C., Deng C., Chen J, & Su J. (2019). Construction of a high-resolution genetic map and identification of quantitative trait loci for salt tolerance in jute (Corchous spp.). BMC Plant Biology, 19, 391.
+ Open protocol
+ Expand
3

GBS Library Construction Using Restriction Enzymes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Restriction enzyme selection for the GBS was performed by predicting fragment sizes that would result from various enzyme combinations, according to the previously described ZZ1 genome, and eventually, the combination of MseI and EcorI was selected for constructing the GBS libraries. GBS libraries were constructed for each line by incubating 0.1–1 μg genomic DNA at 37 °C with MseI (New England Biolabs, i.e., NEB, Ipswich, MA, USA), T4 DNA ligase (NEB), ATP (NEB), and MseI Y adapter N, which contained barcodes, and then heat-inactivating the reaction mixtures at 65 °C. EcoRI (NEB) was then added to the MseI digests and incubated at 37 °C. Thereafter, the fragments of each sample were purified using Agencourt AMPure XP (Beckman) and subject to PCR amplification using Phusion Master Mix (NEB), universal primer, and index primer. The resulting PCR products of each sample were purified using Agencourt AMPure XP (Beckman), pooled, and visualized on a 2% agarose gel, and fragments of 400–450 bp (including indexes and adaptors) were excised from the gel and purified using a gel extraction kit (QIAGEN, Valencia, CA, USA). The purified fragments were cleaned further using Agencourt AMPure XP (Beckman) prior to sequencing. Finally, paired-end sequencing was performed on the selected tags by Novogene Bioinformatics Institute (Beijing, China) using an Illumina 2500 platform (Illumina, USA).
Liu C., Zhu S., Tang S., Wang H., Zheng X., Chen X., Dai Q, & Liu T. (2017). QTL analysis of four main stem bark traits using a GBS-SNP-based high-density genetic map in ramie. Scientific Reports, 7, 13458.
+ Open protocol
+ Expand
4

Liver Transcriptome Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
We sequenced the liver tissue transcriptomes to access a large number of diverse transcripts because the liver is a highly complex organ with a complex transcriptome (Shackel et al. 2002 (link), 2006 (link)). Total RNA was isolated using TRIzol reagent (Life Technologies Corp., Carlsbad, CA) according to the manufacturer’s protocols, and cleaned up using the RNeasy mini kit (Qiagen, Valencia, CA). RNA samples were quantified with the 2100 Bioanalyzer (Agilent Technologies). mRNA was enriched using beads with oligo (dT) and fragmented using fragmentation buffer. The first cDNA chain was synthesized using random hexamers, and the second chain was synthesized with buffer, dNTPs, RNase H, and DNA polymerase I. After the cDNA was purified using Agencourt AMPure XP (Beckman Coulter Inc., Atlanta, GA), the samples were blunt-end repaired and ligated with poly(A) and adapter sequences. Then, sizes were selected using Agencourt AMPure XP (Beckman Coulter Inc., Atlanta, GA). Each of the libraries was amplified by PCR. The libraries were quantified by RT-PCR, and transcriptome sequencing was performed on an Illumina HiSequation 2500 platform. Short sequence reads of paired end (PE) 100 bp were generated. All of the data were deposited into the NCBI Sequence Read Archive database (SRA run accession numbers are provided in Table S1).
Ma X., Dai W., Kang J., Yang L, & He S. (2015). Comprehensive Transcriptome Analysis of Six Catfish Species from an Altitude Gradient Reveals Adaptive Evolution in Tibetan Fishes. G3: Genes|Genomes|Genetics, 6(1), 141-148.
+ Open protocol
+ Expand
5

Strand-specific RNA Sequencing Library Preparation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For cDNA synthesis, we used a custom oligo-dT primer with a barcode and adaptor-linker sequence (CCTACACGACGCTCTTCCGATCT-xrefXX-T15). After first-strand synthesis, samples were pooled together based on Actb qPCR values and RNA-DNA hybrids were degraded with consecutive acid-alkali treatment. Subsequently, a second sequencing linker (AGATCGGAAGAGCACACGTCTG) was ligated with T4 ligase (NEB) followed by clean up with solid phase reverse immobilization (SPRI)-beads (Agencourt AMPure XP, BeckmanCoulter). The mixture was enriched by PCR for 12 cycles and purified with SPRI-beads (Agencourt AMPure XP, BeckmanCoulter) to yield final strand-specific RNA sequencing libraries. Libraries were sequenced on the HiSeq 2500 platform (Illumina) using 50 bp x 25 bp paired-end sequencing. Second read (read-mate) was used for sample demultiplexing. Reads were aligned to the GRCm38.p2 assembly of the mouse genome using STAR aligner43 (link). Aligned reads were quantified using quant3p script (https://github.com/ctlab/quant3p). GENCODE genome annotation was used and DESeq244 (link) was used for differential gene expression analysis. Pre-ranked gene set enrichment analysis was done using fgsea R package45 (link). Genes were ranked according to Wald-statistics from DESeq2 analysis, only top 10000 genes ordered by mean expression were considered. MSigDB C2 gene set collection was used.
Howard N.C., Marin N.D., Ahmed M., Rosa B.A., Martin J., Bambouskova M., Sergushichev A., Loginicheva E., Kurepina N., Rangel-Moreno J., Chen L., Kreiswirth B.N., Klein R.S., Balada-Llasat J.M., Torrelles J.B., Amarasinghe G.K., Mitreva M., Artyomov M.N., Hsu F.F., Mathema B, & Khader S.A. (2018). Mycobacterium tuberculosis carrying a rifampicin drug resistance mutation reprograms macrophage metabolism through cell wall lipid changes. Nature microbiology, 3(10), 1099-1108.
+ Open protocol
+ Expand
6

Strand-specific RNA Sequencing Library Preparation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For cDNA synthesis, we used a custom oligo-dT primer with a barcode and adaptor-linker sequence (CCTACACGACGCTCTTCCGATCT-xrefXX-T15). After first-strand synthesis, samples were pooled together based on Actb qPCR values and RNA-DNA hybrids were degraded with consecutive acid-alkali treatment. Subsequently, a second sequencing linker (AGATCGGAAGAGCACACGTCTG) was ligated with T4 ligase (NEB) followed by clean up with solid phase reverse immobilization (SPRI)-beads (Agencourt AMPure XP, BeckmanCoulter). The mixture was enriched by PCR for 12 cycles and purified with SPRI-beads (Agencourt AMPure XP, BeckmanCoulter) to yield final strand-specific RNA sequencing libraries. Libraries were sequenced on the HiSeq 2500 platform (Illumina) using 50 bp x 25 bp paired-end sequencing. Second read (read-mate) was used for sample demultiplexing. Reads were aligned to the GRCm38.p2 assembly of the mouse genome using STAR aligner43 (link). Aligned reads were quantified using quant3p script (https://github.com/ctlab/quant3p). GENCODE genome annotation was used and DESeq244 (link) was used for differential gene expression analysis. Pre-ranked gene set enrichment analysis was done using fgsea R package45 (link). Genes were ranked according to Wald-statistics from DESeq2 analysis, only top 10000 genes ordered by mean expression were considered. MSigDB C2 gene set collection was used.
Howard N.C., Marin N.D., Ahmed M., Rosa B.A., Martin J., Bambouskova M., Sergushichev A., Loginicheva E., Kurepina N., Rangel-Moreno J., Chen L., Kreiswirth B.N., Klein R.S., Balada-Llasat J.M., Torrelles J.B., Amarasinghe G.K., Mitreva M., Artyomov M.N., Hsu F.F., Mathema B, & Khader S.A. (2018). Mycobacterium tuberculosis carrying a rifampicin drug resistance mutation reprograms macrophage metabolism through cell wall lipid changes. Nature microbiology, 3(10), 1099-1108.
+ Open protocol
+ Expand
7

Ion AmpliSeq Cancer Panel Enrichment

Check if the same lab product or an alternative is used in the 5 most similar protocols
For comparative studies, a subset of our samples was also enriched for specific target sequences using the Ion AmpliSeq Cancer Panel 1.0 (Life Technologies) according to the manufacturer’s protocol. Briefly, 10 ng of cell line or FFPE DNA samples were pre-amplified in 19 cycles of PCR (98°C for 15 s and 60°C for 4 min) and the products were purified using magnetic bead purification (Agencourt AMPure XP, Beckman Coulter). The purified PCR fragments were 5’ phosphorylated and ligated to the adaptor needed for emulsion PCR using the Ion Torrent system (Life Technologies). The AMPure-purified ligation products were nick translated at 72°C for 1 min and amplified using 10 cycles of PCR (98°C for 15 s, 60°C for 4 min). The amplified library products were purified using magnetic bead purification (Agencourt AMPure XP, Beckman Coulter) and quantified using a Bioanalyzer and High Sensitivity DNA chip (Agilent Technologies). Approximately 44 million copies of library DNA were used for emulsion PCR on the Ion One Touch Instrument (Life Technologies), and 50% of enriched products were loaded onto Ion 316 chips for sequencing on the Ion PGM system (Life Technologies).
Choudhary A., Mambo E., Sanford T., Boedigheimer M., Twomey B., Califano J., Hadd A., Oliner K.S., Beaudenon S., Latham G.J, & Adai A.T. (2014). Evaluation of an integrated clinical workflow for targeted next-generation sequencing of low-quality tumor DNA using a 51-gene enrichment panel. BMC Medical Genomics, 7, 62.
+ Open protocol
+ Expand
8

Bacterial RNA-Seq Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Libraries for RNA-sequencing were prepared using the ScriptSeq Complete (Bacteria) sample prep kit (Epicentre – Illumina, San Diego, CA, USA). Starting material (1000 ng) of total RNA was depleted of rRNAs using Ribo-Zero magnetic bead based capture-probe system (Illumina, Hayward, USA). Remaining RNA (including mRNAs, lin-cRNAs and other RNA species) was subsequently purified (Agencourt RNA- Clean XP, Beckman Coulter, Brea, CA, USA) and fragmented using enzymatic fragmentation. First strand synthesis and second strand synthesis were performed and double stranded cDNA was purified (AgencourtAMPure XP, Beckman Coulter). RNA stranded libraries were pre-amplified and purified (AgencourtAMPure XP, Beckman Coulter). Library size distribution was validated and quality inspected using the 2100 Bioanalyzer (high sensitivity DNA chip, Agilent Technologies). High quality libraries were quantified using the Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), concentration normalized and samples pooled according to number of reads. Sequencing was performed on a NextSeq500 instrument using Mid Output sequencing kit (150 cycles) according to manufacturer’s instructions (Illumina, Hayward, USA).
Scoma A., Barbato M., Hernandez-Sanabria E., Mapelli F., Daffonchio D., Borin S, & Boon N. (2016). Microbial oil-degradation under mild hydrostatic pressure (10 MPa): which pathways are impacted in piezosensitive hydrocarbonoclastic bacteria?. Scientific Reports, 6, 23526.
+ Open protocol
+ Expand
9

ChIP-Seq Library Preparation and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Libraries were prepared using the NEXTflex ChIP-Seq kit (Bio Scientific) following the “No size-selection cleanup” protocol. Each sample of ChIPed DNA was end-repaired and ligated to unique barcoded adaptors to produce individual libraries. Libraries corresponding to samples to be directly compared to each other (e.g. DMSO vs UNC7040) were pooled together and purified using 1 volume of Agencourt AMPure XP (Beckman Coulter). The pooled libraries were eluted with 23 μL of elution buffer (NEXTflex ChIP-Seq kit) and amplified using the KAPA Real-Time Library Amplification Kit (KAPABiosystems) following the kit instructions. Finally, the amplified libraries were size-selected and purified using 0.9x volume of Agencourt AMPure XP (Beckman Coulter). Library quality control including determination of average size and concentration was performed prior to sequencing by commercial Next Generation Sequencing providers. NGS libaries were eventually sequenced as 150 bp paired-end reads on the Illumina HiSeq platform.
Suh J.L., Bsteh D., Hart B., Si Y., Weaver T.M., Pribitzer C., Lau R., Soni S., Ogana H., Rectenwald J.M., Norris J.L., Cholensky S.H., Sagum C., Umana J.D., Li D., Hardy B., Bedford M.T., Mumenthaler S.M., Lenz H.J., Kim Y.M., Wang G.G., Pearce K.H., James L.I., Kireev D.B., Musselman C.A., Frye S.V, & Bell O. (2021). Reprogramming CBX8-PRC1 function with a positive allosteric modulator. Cell chemical biology, 29(4), 555-571.e11.
+ Open protocol
+ Expand
10

Genotyping-by-sequencing for grassPea

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
GBS sequencing was conducted according to the method of Elshire et al., 2011 [29 (link)], with minor improvements. Briefly, the gDNA from 154 grasspea plants (2 parents and 152 F2 progeny) was first digested by MseI (5’-T!TAA-3’) (New England Biolabs, ‘NEB’, Ipswich, MA, USA) at 37 °C, then subjected to restriction-ligation by T4 DNA ligase (NEB) and ATP (NEB) with a MseI Y-adapter N-containing barcode at 65 °C, followed by a second digestion with HaeIII (5’-GG!CC-3’) (NEB) at 37 °C. The digested fragments were purified using Agencourt AMPure XP (Beckman Coulter, ‘Beckman’, Brea, CA, USA) and used for PCR amplification, utilizing Phusion Master Mix (NEB) to add universal and index primers, as well as i5 and i7 index sequences, to the digested fragments. The purified PCR fragments (425–490 bp including indexes and adaptors) were screened and extracted using a 2% agarose gel with the Gel Extraction Kit (Qiagen, Valencia, CA, USA). The amplification products were purified using Agencourt AMPure XP (Beckman) and diluted before sequencing. Finally, an Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA) was used to perform 150-bp paired-end sequencing by Tianjin Novogene Technology Co., Ltd. (Tianjin, China).
Hao X., Yang T., Wang Y., Liu R., Dong X., Zhao J., Han J., Zong X., Chang J, & Liu H. (2022). Construction of A GBS-Based High-Density Genetic Map and Flower Color-Related Loci Mapping in Grasspea (Lathyrus sativus L.). Plants, 11(16), 2172.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!