Log In Sign up
The largest database of trusted experimental protocols

Abi 7900ht thermal cycler

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The ABI 7900HT thermal cycler is a high-throughput instrument designed for real-time PCR analysis. It features 384-well block format and supports a wide range of quantitative and qualitative PCR applications.

Automatically generated - may contain errors

Lab products found in correlation

Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (8 mentions) Trizol, by Thermo Fisher Scientific (4 mentions) Maxima sybr green qpcr master mix, by Thermo Fisher Scientific (3 mentions) Rneasy mini kit, by Qiagen (3 mentions) Rneasy plus universal mini kit, by Qiagen (3 mentions) Verso cdna kit, by Thermo Fisher Scientific (2 mentions) Affinityscript multitemp rt, by Agilent Technologies (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Platinum taq dna polymerase, by Thermo Fisher Scientific (2 mentions) Sybr green, by Thermo Fisher Scientific (2 mentions) High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions) Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions) Superscript 3, by Thermo Fisher Scientific (1 mentions) Sybr select master mix, by Thermo Fisher Scientific (1 mentions) Qscript cdna supermix, by Quanta Biosciences (1 mentions) Rneasy plus mini kit, by Qiagen (1 mentions) Superscript 2 reverse, by Thermo Fisher Scientific (1 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions) Random hexamer, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

ABI 7900HT (358 citations) Thermal cycler (242 citations) 7900HT thermal cycler (27 citations) 7900HT cycler (13 citations) ABI thermal cycler (12 citations) ABI Prism 7900HT Thermal Cycler (9 citations) ABI 7900HT cycler (6 citations)

21 protocols using abi 7900ht thermal cycler

1

Quantification of MyoG Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from transfected MB differentiated for 36 hours using Trizol (Cat No. 15596-026, Thermo Scientific) as per manufacturer’s instructions. cDNA was synthesised using Superscript III (Cat No. 18080-044, Thermo Scientific), amplified by qRT-PCR using Maxima SYBR Green 2X PCR master mix (Cat No.K0222, Fermentas) and analysed in triplicates on a ABI 7900HT thermal cycler (Applied Biosystems). Amplicons were verified by sequencing and dissociation curves. Relative level of endogenous MyoG mRNA in the transfected samples was calculated with respect to untransfected control after normalising to corresponding GAPDH levels in the transfected samples. Fold change between samples was calculated using [2(−ΔΔCt)] method. Primers: GAPDH 5′-AAGGCCGGGGCCCACTTGAA-3′, 5′-AGCAGTTGGTGGTGCAGGATGC-3′; MyoG 5′-CAACCAGCGGCTGCCTAAAGTGG 3′, 5′-GCATTCACTGGGCACCATGGGC -3′.
Saleh A., Subramaniam G., Raychaudhuri S, & Dhawan J. (2019). Cytoplasmic sequestration of the RhoA effector mDiaphanous1 by Prohibitin2 promotes muscle differentiation. Scientific Reports, 9, 8302.
+ Open protocol
+ Expand
2

Quantifying Muscle Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prior to sampling for RNA, dissected samples of quadriceps muscle were snap-frozen and mashed under liquid nitrogen to powder. Samples were stored at -80°C until analyses. Total RNA was isolated from musculus quadriceps using RNeasy Plus Universal Mini Kit (Qiagen, Valencia, CA, USA), and reverse transcription was performed using Maxima First Strand cDNA Synthesis Kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer's protocol. Real-time PCRs were carried out applying Maxima SYBR Green qPCR Master Mix (Thermo Fisher, Waltham, MA, USA) and run on an ABI 7900HT thermal cycler (Applied Biosystems, Life Technologies, Carlsbad, CA, USA) using rat-specific primer pairs shown in Table 1. Data were normalized to the expression of housekeeping gene ribosomal protein S29 (Rps29) which was not altered by the treatment.
Dobrocsyova V., Slamkova M., Krskova K., Balazova L., Suski M., Olszanecki R., Cacanyiova S, & Zorad S. (2020). AVE0991, a Nonpeptide Angiotensin 1-7 Receptor Agonist, Improves Glucose Metabolism in the Skeletal Muscle of Obese Zucker Rats: Possible Involvement of Prooxidant/Antioxidant Mechanisms. Oxidative Medicine and Cellular Longevity, 2020, 6372935.
+ Open protocol
+ Expand
3

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from liver tissues and primary human hepatocytes using Trizol (Invitrogen). cDNA was amplified using 3 μg of total RNA using qScript cDNA SuperMix (Quanta BioSciences, Beverly, MA, USA). Quantitative real time PCR (RT-PCR) analysis was performed using SYBR® Select Master Mix (Applied Biosystems) and an ABI 7900HT thermal cycler (Applied Biosystems, Thermo Fisher Scientific). Ct values were normalized to 18s rRNA and are expressed as fold change over samples from mice fed NC or cultured human hepatocytes without NCT.
Veeriah V., Lee S.H, & Levine F. (2022). Long-term oral administration of an HNF4α agonist prevents weight gain and hepatic steatosis by promoting increased mitochondrial mass and function. Cell Death & Disease, 13(1), 89.
+ Open protocol
+ Expand
4

Quantification of Gene Expression in Rat Adipocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from differentiated primary rat adipocytes using RNeasy Universal Plus Mini Kit (Qiagen, Valencia, CA, USA) and reverse transcription was performed using Maxima First Strand cDNA Synthesis Kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s protocol. Real-time PCR was carried out by applying Maxima Sybr Green qPCR Master Mix (Thermo Fisher, Waltham, MA, USA) and run on an ABI 7900HT thermal cycler (Applied Biosystems, Life Technologies, Carlsbad, CA, USA) using rat-specific primer pairs, as shown in Table 1. Data were normalized to the expression of housekeeping gene ribosomal protein S29 (Rps29) which was not altered by QCT or OTA.
Dobrocsyova V., Krskova K., Capcarova M, & Zorad S. (2019). Modulation of Adipogenesis and Oxidative Status by Quercetin and Ochratoxin A: Positive or Negative Impact on Rat Adipocyte Metabolism?. Molecules, 24(20), 3726.
+ Open protocol
+ Expand
5

Quantifying Gene Expression Alterations

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total cellular RNA extraction was performed with TRIzol (Invitrogen) and chloroform. cDNA was synthesized with the Verso cDNA kit (ThermoFisher Scientific) and subjected to qPCR analysis with Radiant™ Green 2X qPCR Mix (Alkali Scientific) on an ABI 7900 HT thermal cycler (Applied Biosystems). The value of each cDNA was calculated using the ΔΔCT method and normalized to the values of the house-keeping gene control, the18s ribosomal RNA. The data were plotted as fold change. The primer sequences are listed below.
Yang M., Zhang D., Zhao Z., Sit J., Saint-Sume M., Shabandri O., Zhang K., Yin L, & Tong X. (2020). Hepatic E4BP4 induction promotes lipid accumulation by suppressing AMPK signaling in response to chemical or diet-induced ER stress. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(10), 13533-13547.
+ Open protocol
+ Expand
6

Quantitative Real-Time PCR Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from grafts or mouse and human culture cells (RNeasy Plus Minikit, QIAGEN). cDNA was synthesized from total RNA using AffinityScript MultiTemp RT (Agilent) with an oligo(dT)18 primer. Real-time PCR was performed using PlatinumTaq DNA polymerase (Thermofisher) and SYBR-green (Thermofisher) on an ABI7900HT thermal cycler (Applied Biosystems). A robust global normalization algorithm, using expression of the housekeeping genes ribosomal protein S11 (Rps11), β-actin (Actb), and α-tubulin (Tuba), was used for all experiments, as described elsewhere (Bordería et al., 2008 (link)). In brief, all crossing threshold (Ct) values were first adjusted by median difference of all samples from Actb. Each individual sample was then further corrected by the median Ct value of the three corrected housekeeping controls for that sample. Nominal copy numbers were calculated by assuming 2500 molecules of Actb mRNA per cell, and an amplification efficiency of 93% using the difference in Ct value (ΔCt method).
González F.F., McGinty M., Ningoo M., Anderson L., Cantarelli C., Angeletti A., Demir M., Llaudó I., Purroy C., Marjanovic N., Heja D., Sealfon S.C., Heeger P.S., Cravedi P, & Fribourg M. (2022). Interferon-β Acts Directly on T cells to Prolong Allograft Survival by Enhancing Regulatory T cell Induction through Foxp3 Acetylation. Immunity, 55(3), 459-474.e7.
+ Open protocol
+ Expand
7

Quantitative Analysis of Telomere Length

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA was extracted from c-Kit-enriched BM cells and mean telomere length was analyzed using a quantitative PCR assay as described [34 (link)]. All samples were analyzed in triplicate using an ABI 7900HT thermal cycler (Applied Biosystems).
Raval A., Behbehani G.K., Nguyen L.X., Thomas D., Kusler B., Garbuzov A., Ramunas J., Holbrook C., Park C.Y., Blau H., Nolan G.P., Artandi S.E, & Mitchell B.S. (2015). Reversibility of Defective Hematopoiesis Caused by Telomere Shortening in Telomerase Knockout Mice. PLoS ONE, 10(7), e0131722.
+ Open protocol
+ Expand
8

Quantification of Tissue RNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prior to sampling for RNA, dissected samples from musculus quadriceps and epididymal adipose tissues were removed, frozen in liquid nitrogen and stored at –80°C until analysis. Total RNA was isolated using RNeasy Plus Universal Mini Kit (Qiagen, Valencia, CA, United States) following the manufacturer’s instructions. The reverse transcription of isolated RNA was performed using Maxima First Strand cDNA Synthesis Kit (Thermo Fisher, Waltham, MA, United States) according to the manufacturer’s protocol. Real-time PCRs were carried out applying Maxima SYBR Green qPCR Master Mix (Thermo Fisher, Waltham, MA, United States) and run on an ABI 7900HT thermal cycler (Applied Biosystems, Life Technologies, Carlsbad, CA, United States) using rat-specific primer pairs as described previously (Dobrocsyova et al., 2020 ). Data were normalized to the expression of housekeeping gene ribosomal protein S29 (Rps29) which was not altered by the treatment.
Krskova K., Balazova L., Dobrocsyova V., Olszanecki R., Suski M., Chai S.Y, & Zorad Š. (2020). Insulin-Regulated Aminopeptidase Inhibition Ameliorates Metabolism in Obese Zucker Rats. Frontiers in Molecular Biosciences, 7, 586225.
+ Open protocol
+ Expand
9

Quantifying Key Hypoxia-Angiogenesis Regulators in HMEC-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from cultured HMEC-1 cells using TRIzol Reagent (Invitrogen). 1 ug RNA was converted to cDNA using SuperScript II reverse transcriptase and random hexamere primers (Life Technologies). CSE (assay Hs00542284_m1), CBS (assay Hs00163925_m1), 3MST (assay Hs00560401_m1), VEGF-A (assay Hs00900055_m1) and VEGFR2 (assay Hs00911700_m1) mRNA expression was measured with a Taqman Gene expression assay (Applied Biosystems). For normalization, TATA box binding protein (TBP) was included as housekeeping gene using the following primers (FW: GCCCGAAACGCCGAATAT; REV: CCGTGGTTCGTGGCTCTCT) and probe (ATCCCAAGCGGTTTGCTGCGG) (Eurogentec). Reactions were performed on an ABI7900HT thermal cycler (Applied Biosystems). The comparative Ct method (2−ΔCt method) was used to calculate relative gene expression.
van den Born J.C., Mencke R., Conroy S., Zeebregts C.J., van Goor H, & Hillebrands J.L. (2016). Cystathionine γ-lyase is expressed in human atherosclerotic plaque microvessels and is involved in micro-angiogenesis. Scientific Reports, 6, 34608.
+ Open protocol
+ Expand
10

Liver RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from liver tissue slices was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The RNA concentrations were measured on a NanoDrop spectrophotometer (ND-2000). cDNA was synthesized using High-Capacity RNA-to-cDNA™ Kit (ThermoFisher Scientific, 4387406) in a volume of 20 μl. cDNA was diluted to 5 ng/μl and 2 μl/reaction (10 ng) and then used for qRT-PCR analysis. PCR reactions were performed in a 10 μl reaction volume containing qPCR master mix (AccuPower ® 2X GreenStar™ qPCR Master Mix). qRT-PCR reactions were performed on a ABI7900HT thermal cycler (Applied Biosystems, Foster City, CA, USA). Relative gene expression was calculated using the 2-ΔΔCt method with GAPDH as housekeeping gene (see in Additional file 1: Table S1).
Park S., In Hwang S., Kim J., Hwang S., Kang S., Yang S., Kim J., Kang W., Kim K.H., Han D.W, & Paik Y.H. (2019). The therapeutic potential of induced hepatocyte-like cells generated by direct reprogramming on hepatic fibrosis. Stem Cell Research & Therapy, 10, 21.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!