Faststart universal probe master rox mix

Manufactured by Roche

Sourced in United States, Germany

FastStart Universal Probe Master (ROX) mix is a pre-formulated reaction mix designed for real-time quantitative PCR (qPCR) analysis. The mix contains FastStart Taq DNA Polymerase, reaction buffer, dNTPs, and ROX reference dye.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Universal Master mix Probes Master Mix Universal probes

16 protocols using faststart universal probe master rox mix

Quantitative PCR Analysis of Viral DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Levels of viral DNA synthesis were determined using quantitative PCR (qPCR), as described previously (44 (link)). Briefly, cells were washed with PBS, lysed in lysis buffer with sonication, and treated with proteinase K. After deactivation of the proteinase, qPCRs were performed using the Fast Start universal probe master mix (Rox; Roche Applied Science). A standard curve determined using serial dilutions of DNA was used to quantify the amount of DNA. The probe and primers for detecting the viral genome were designed to target the BALF2-coding region.

Konishi N., Narita Y., Hijioka F., Masud H.M., Sato Y., Kimura H, & Murata T. (2018). BGLF2 Increases Infectivity of Epstein-Barr Virus by Activating AP-1 upon De Novo Infection. mSphere, 3(2), e00138-18.

+ Open protocol

+ Expand

qPCR Analysis of Piezo2 in DRG Neurons

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR analysis was performed as previously described (14 (link)). Briefly, total RNA was extracted using TRIzol/chloroform and isopropanol precipitation from freshly isolated dorsal root ganglion neurons (Life Technologies). Generation of complementary DNA was achieved by reverse transcription using the QuantiTect Reverse Transcript kit (Qiagen). For qPCR, FastStart Universal probe master mix (Rox) from Roche Diagnostics was used. The reaction was run in the Eco RealTime PCR instrument (Illumina) using 0.5 μl of the cDNA in a 10 μl reaction according to the manufacturer’s instructions. Real-time Taqman qPCR assays were purchased from Integrated DNA Technologies with a FAM reporter dye and a non-fluorescent quencher: mouse Piezo2 (Mm.PT.56a.32860700), and an internally designed mouse Gapdh assay (forward primer: GCACCACCAACTGCTTAG; reverse primer: GGATGCAGGGATGATGTTC; and probe: CAGAAGACTGTGGATGGCCCCTC).

Murthy S.E., Loud M.C., Daou I., Marshall K.L., Schwaller F., Kühnemund J., Francisco A.G., Keenan W.T., Dubin A.E., Lewin G.R, & Patapoutian A. (2018). The mechanosensitive ion channel Piezo2 mediates sensitivity to mechanical pain in mice. Science translational medicine, 10(462), eaat9897.

+ Open protocol

+ Expand

Total RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using a Tissue Total RNA Mini Kit (Geneaid, Taipei, Taiwan) by following the manufacturer’s instructions. In-column DNase I digestion was performed to remove genomic DNA contamination. Reverse transcription was then performed using Superscript IV (Invitrogen) and Oligo(dT)₂₀ primers by following the manufacturer’s guidelines. For the amplification by polymerase chain reaction (PCR), it was done with a denaturation step at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 sec, primer annealing at 60 °C for 30 sec, and primer extension at 72 °C for 1 min. Upon completion of the cycling steps, a final extension at 72 °C for 5 min was done and then the reaction was stored at 4 °C. The primers for PCR analysis are listed in Table S4. For qPCR analysis, TaqMan PCRs were carried out using FastStart Universal Probe Master Mix (ROX) (Roche) and the StepOnePlus real-time PCR system (Thermo Fisher Scientific). Primers were intron-spanning and designed using the Universal ProbeLibrary Assay Design Center (Roche). The primers and probes for qPCR analysis are listed in Table S5.

Wu P.C., Fann M.J., Tran T.T., Chen S.C., Devina T., Cheng I.H., Lien C.C., Kao L.S., Wang S.J., Fuh J.L., Tzeng T.T., Huang C.Y., Shiao Y.J, & Wong Y.H. (2019). Assessing the therapeutic potential of Graptopetalum paraguayense on Alzheimer’s disease using patient iPSC-derived neurons. Scientific Reports, 9, 19301.

+ Open protocol

+ Expand

Comparison of Chrna6 Expression Across Tissues and Mouse Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

For tissue comparison experiments, DRGs were freshly isolated from adult male C57BL/6J mice and snap frozen on dry ice, and total RNA was isolated using Trizol treatment. Total RNA from all other tissues was purchased from Zyagen. For strain comparison experiments, DRGs from different inbred strains were isolated (n=3 mice/sex/strain) and treated similarly. Two hundred ng of total RNA was used to generate the first-strand cDNA using the Quantitect Reverse transcript kit (Qiagen). A real time Taqman PCR assay for Chrna6 (Assay ID: Mm00517529_m1) was purchased from Life Technologies, with a FAM reporter dye and a non-fluorescent quencher. FastStart Universal probe master mix (Rox) from Roche Diagnostics was used. The reaction was run, in triplicate, in the ABI 7900HT fast real time system using 0.5 μl of the cDNA in a 10-μl reaction as per the manufacturer’s instructions.
Calibrations and normalizations were done using the 2^−∆∆CT method. The target gene was Chrna6, while the reference gene was Actb (β-actin). The calibrator for the tissue comparisons was the DRG; the calibrator for the strain comparisons was the DBA/2 strain.

Wieskopf J.S., Mathur J., Limapichat W., Post M.R., Al-Qazzaz M., Sorge R.E., Martin L.J., Zaykin D.V., Smith S.B., Freitas K., Austin J.S., Dai F., Zhang J., Marcovitz J., Tuttle A.H., Slepian P.M., Clarke S., Drenan R.M., Janes J., Sharari S.A., Segall S.K., Aasvang E.K., Lai W., Bittner R., Richards C.I., Slade G.D., Kehlet H., Walker J., Maskos U., Changeux J.P., Devor M., Maixner W., Diatchenko L., Belfer I., Dougherty D.A., Su A.I., Lummis S.C., Damaj M.I., Lester H.A., Patapoutian A, & Mogil J.S. (2015). The Nicotinic α6 Subunit Gene Determines Variability in Chronic Pain Sensitivity via Cross-inhibition of P2X2/3 Receptors. Science translational medicine, 7(287), 287ra72.

+ Open protocol

+ Expand

Quantification of PC2 Expression in Cholangiocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cholangiocytes using TRIzol Reagent (Invitrogen) according to the manufacturer's instructions. Briefly, 800 ng RNA were converted into a PCR template using the TaqMan Reverse Transcription Kit (Applied Biosystems), which was then used for the real-time PCR analysis using commercially available specific FAM conjugated probes for PC2 and GAPDH (Applied Biosystems) in combination with the Fast Start Universal Probe Master mix (Rox) (Roche Diagnostics, Indianapolis, IN) on an Applied Biosystems 7500 Real-Time PCR system. Data were normalized against the housekeeping gene and analyzed using the ΔΔCt method.

Spirli C., Villani A., Mariotti V., Fabris L., Fiorotto R, & Strazzabosco M. (2015). Post-Translational Regulation of Polycystin-2 Protein Expression as a Novel Mechanism of Cholangiocyte Reaction and Repair from Biliary Damage. Hepatology (Baltimore, Md.), 62(6), 1828-1839.

+ Open protocol

+ Expand

Tibia Cortical Bone Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from tibia diaphyses (isolated cortical tubes with periosteum and marrow removed) using previously described cryo‐pulverization and Qiagen RNeasy kits.⁽³⁾ cDNAs were reverse transcribed from 250 ng of total RNA using high‐capacity cDNA reverse transcription kits (Applied Biosystems). Quantitative PCR was performed on an ABI Quantstudio Flex 7 (Applied Biosystems) using FastStart Universal Probe Master ROX mix (Roche). Sost and Dkk1 expression were calculated using the 2−ΔCt method, and normalized to transcripts for the housekeeper eukaryotic translation initiation factor3 (EIF3F). Sost (Mm00470479_m1) and Dkk1 (Mm00470479_m1) Taqman primer/probe mixes were purchased from ABI. EIF3F primers were customized by Roche Life Science Universal Probe Library (UPL) assay system: Left‐attcacctcacggtggaca Right‐agggacacccattaaagtgct.

Choi R.B., Bullock W.A., Hoggatt A.M., Loots G.G., Genetos D.C, & Robling A.G. (2021). Improving Bone Health by Optimizing the Anabolic Action of Wnt Inhibitor Multitargeting. JBMR Plus, 5(5), e10462.

+ Open protocol

+ Expand

Quantitative Analysis of Large T Antigen mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cultured cells using TRI reagent (Sigma-Aldrich, St. Louis, MO) per the manufacturer’s instructions. Two micrograms of RNA was converted to cDNA using RevertAid H minus reverse transcriptase (Thermo Scientific, Waltham, MA) per the manufacturer’s instructions. Viral large T antigen (LT-Ag) mRNA was quantified by quantitative PCR (qPCR) with FastStart Universal Probe Master (ROX) mix (Roche) using an ABI PRISM 5700 sequence detection system (Applied Biosystems, Foster, CA) using a forward primer (5′-AGGAATTGAACAGTCTCTGGG-3′), reverse primer (5′-GTCATCGTGTAGTGGACTGTG-3′), and TaqMan probe (5′-AGAGCCCTGGAAGCCGGTT-3′) (Integrated DNA Technologies, Coralville, IA). Validated TATA box-binding protein (Tbp) gene TaqMan primers from Integrated DNA Technologies were used as a housekeeping control gene for normalization of LT-Ag mRNA threshold cycle (C_T) values. A standard curve of known copy number for LT-Ag mRNA was performed using a plasmid containing a cloned LT-Ag mRNA amplicon.

Maru S., Jin G., Desai D., Amin S., S.h.w.e.t.a.n.k., Lauver M.D, & Lukacher A.E. (2017). Inhibition of Retrograde Transport Limits Polyomavirus Infection In Vivo. mSphere, 2(6), e00494-17.

+ Open protocol

+ Expand

Quantitative analysis of midbrain gene expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Midbrain from mice aged 6 months were extracted with Trizol (Invitrogen) following manufacturer’s instructions. Before cDNA synthesis, 1 μg of RNA was digested with DNase I Amplification Grade (Invitrogen). Reverse transcription was performed with SuperScript III Reverse Transcriptase (Invitrogen). Subsequently, expression levels were measured with the StepOnePlus Real-Time PCR System (Applied Biosystems) using cDNA from 25 ng RNA, 10 μl of FastStart Universal Probe Master (Rox) Mix (04914058001, Roche) and 1 μl of one of the following TaqMan Assays (Applied Biosystems): Adora2b (Mm00839292_m1), Dapk1 (Mm01352536_m1), Dcaf17 (Mm01334341_m1), Dctn5 (Mm00727515_s1), Homer1 (Mm00516275_m1), Mrpl9 (Mm00659648_m1), Mrpl9 (Mm00659648_m1), Pink1 (Mm00550827_m1) as independent control of genotypes, Rab42 (Mm01187370_g1), Tmem181a (Mm02581460_g1), Xaf1 (Mm01248390_m1), Lect1 (Mm00495291_m1) and Tbp (Mm00446973_m1) as endogenous control. Expression changes were analyzed both with the 2^−ΔΔCt method, as previously described (77 (link)).

Gispert S., Brehm N., Weil J., Seidel K., Rüb U., Kern B., Walter M., Roeper J, & Auburger G. (2014). Potentiation of neurotoxicity in double-mutant mice with Pink1 ablation and A53T-SNCA overexpression. Human Molecular Genetics, 24(4), 1061-1076.

+ Open protocol

+ Expand

Genotyping of rs55933544 and rs74438701

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from the total blood cells using a commercial kit (Qiagen K.K., Tokyo, Japan) following standard protocol. Genotyping assays were performed on the LightCycler 480 (Roche Applied Science, Mannheim, Germany) with specific TaqMan probes designed for rs55933544 and rs74438701 (Applied Biosystems, Foster City, CA). Real-time PCR was performed with 4 μl of genomic DNA resolved in 16 μl of reaction mixtures which contained 12 μl of FastStart Universal Probe Master (ROX) mix (Roche Diagnostics, Indianapolis, IN, USA) and 4 μl of TaqMan probes. The thermal cycling condition was as follows, denaturation at 95 °C for 10 min, followed by 45 cycles of denaturation at 92 °C for 15 s and annealing/extension at 60 °C for 1 min.

Lin Q., Han J., Sun Q., Wen L, & Wang S. (2019). Functional variant of IL33 is associated with survival of osteosarcoma patients. Journal of Bone Oncology, 20, 100270.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Neuroinflammation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCR was performed using TaqMan probes and primers for the genes encoding Tnf-α (Rn99999017_m1), Bdnf (Rn02531967), Ngf (Rn01533872_m1), and Bax (Rn02532082_g1) (Applied Biosystems, Foster, CA, USA) and the FastStart Universal Probe Master (Rox) kit (Roche Diagnostic, Germany). Amplification was performed in a total volume of 20 µl of mixture, which contained 1× FastStart Universal Probe Master (Rox) mix (Roche, Germany), 50 ng of cDNA used as the PCR template, 900 nM TaqMan forward and reverse primers, and a 250 nM hydrolysis probe labeled with the fluorescent reporter dye FAM at the 5′-end and with a quenching dye at the 3′-end. The thermal cycling conditions were as follows: 2 min at 50 °C and 10 min at 95 °C, followed by 40 cycles at 95 °C for 15 s and 1 min at 60 °C. The samples were run in duplicate (CFX96 Real-Time System, BIO-RAD, Hercules, CA, USA). The threshold value (C_t) for each sample was set in the exponential phase of the PCR, and the

Δ Δ^{C_{t}}

method was used for data analysis. Beta-2-microglobulin (B₂M, Rn00560865_m1) was used as the reference gene.

Kurek A., Kucharczyk M., Detka J., Ślusarczyk J., Trojan E., Głombik K., Bojarski B., Ludwikowska A., Lasoń W, & Budziszewska B. (2016). Pro-apoptotic Action of Corticosterone in Hippocampal Organotypic Cultures. Neurotoxicity Research, 30, 225-238.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!