A chromatin immunoprecipitation (ChIP) assay was carried out using the ChiP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation Kit or the Re-ChIP-IT kit (Active Motif, Carlsbad, CA) according to the manufacturer’s protocol. Approximately 300 mg of liver tissue was minced, homogenized, and fixed with 1% formaldehyde for the in vivo ChIP assay. The following ChIP primer sets were used for the ChIP assay: human AHR ChIP primer set I (−283 to 90, forward): 5′-TTA GCT GAC CCA CCG TCT CT-3′, (−283 to −90, reverse): 5′-TCC ATT CCG TCT TCC TTG AG-3′; human AHR ChIP primer set II (−1969 to −1779, forward): 5′-TTA GCT GAC CCA CCG TCT CT-3′, (−1969 to −1779, reverse): 5′-TTG GCT ATT TGG TGC AGT CA-3′; Mouse AHR ChIP primer set (−138 to +141, forward): 5′-AGA ACC TCG GAC TGC AAG AA-3′, (−138∼ +141, reverse): 5′-AGT CCG TCC ACC AGT TCG T-3′. For ChIP assays, NR2E3 antibody from Santa Cruz Biotech (Cat#: sc-292264) or Aviva Systems Biology (Cat#: ARP39069) was employed. All the ChIP-PCR reactions were performed using a 7300HT Real-Time PCR System with a 96-well block module (Applied Biosystems). The cycling conditions were 56 °C for 30 min and 95 °C for 10 min, followed by 50 cycles of 95 °C for 25 s and 60 °C for 60 s.
Chip it express enzymatic magnetic chromatin immunoprecipitation kit
Manufactured by Active Motif
The ChiP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation Kit is a lab equipment product designed for chromatin immunoprecipitation (ChIP) experiments. It utilizes enzymatic digestion and magnetic beads to isolate DNA-protein complexes from cell samples.
Automatically generated - may contain errors
Lab products found in correlation
7300ht real time pcr system, by Thermo Fisher Scientific (2 mentions)
96 well block module, by Thermo Fisher Scientific (2 mentions)
Chromatin ip dna purification kit, by Active Motif (2 mentions)
Re chip it kit, by Active Motif (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
Sybr green, by ABclonal (1 mentions)
Quantstudio 7 flex, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
9 protocols using chip it express enzymatic magnetic chromatin immunoprecipitation kit
1
Chromatin Immunoprecipitation (ChIP) Assay
2
Investigating FUS-DNA Interactions in EGF Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Serum-starved HEK293 cells expressing RFP-FUS or RFP-FUS-Y6/296F were treated with vehicle (serum-free medium) or EGF (20 ng/ml). After 30 min, cells were harvested, and the nuclear FUS-DNA complex was isolated using ChIP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation Kit (Active Motif; 53009) according to the manufacturer’s instructions. Briefly, proteins and DNA were cross-linked with 1% PFA. After 15 min, the cross-link reaction was stopped by incubation with Glycine Stop-Solution. After chromatin shearing, FUS was immunoprecipitated using RFP-TRAP beads (Cromteck). DNA was eluted from the beads with Elution Buffer AM2. DNA amplification was performed using the following human collagen IV α2 promoter primers: 5′-CTTGGAGAAGGCAGCTCGT-3′ (forward) and 5′-TGCCCAAAGCAACGAAAACG-3′ (reverse).
3
SIRT6 Regulation of Ovarian Granulosa Cell Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed using ChIP‐IT Express Enzymatic Magnetic Chromatin Immunoprecipitation Kit (Active Motif) following the manufacturer's protocols. WT, SIRT6 KD, and SIRT6 overexpression (OE) ovarian granulosa cell lines were used as materials and special primers were designed to amplify the promoter sequence of Cyp11a1, Plod1, and Mgarp. The primers used for PCR analysis are shown in Table S2 . The antibodies specific for SIRT6 were purchased from Abcam, and the control antibody of normal rabbit IgG was purchased from Cell Signaling Technology.
4
Chromatin Immunoprecipitation of Estrogen Receptors
5
ChIP Assay for Nuclear Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A ChIP assay for various nuclear proteins was performed using ChIP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation kit (Active Motif). In brief, 1×107 cells were fixed with fixation solution at room temperature for 10 min and stopped by adding glycine buffer. The cells were resuspended in ice-cold lysis buffers provided in the kit and homogenized to aid in nuclei release. To sheared DNA (200–400 bp), nuclei solutions were resuspended and digested for 5 min at 37℃ by enzyme buffers provided in the kit. For immunoprecipitation reactions, samples were incubated with 1 μg of intended antibodies or isotype control (rabbit/mouse IgG) and Protein G Magnetic Beads for overnight at 4℃. The magnetic beads were washed by buffers in the kit. The DNA-protein complex was eluted by heating at 95℃ for 15 min in a thermocycler. The DNA were isolated by adding proteinase K to digest binding proteins and stopped by stopping buffer in kit. The DNA was then subjected to real-time PCR or routine PCR analysis. The primers for ChIP-PCR were listed in Supplementary file 1e .
6
ChIP-seq Protocol for Chromatin Shearing and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sheared chromatin was prepared by enzymatic shearing using Enzymatic Shearing Kit, and chromatin immunoprecipitation was performed using ChIP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation Kit (Active Motif [America] Co., Ltd) in accordance with the manufacturer's instructions. Purification of DNA from Chromatin Immunoprecipitation sample was performed using Chromatin IP DNA Purification Kit (Active Motif [America] Co., Ltd) according to the conditions specified by the manufacturer. Real-time PCR was performed on Bio-Rad CFX96 Real-Time System. Primer sequences were as follows: GGGGAGAGCTCACATTCTAAAC (farward); GCAAGTGTTTGGCTGACTCAC (reverse).
7
ChIP-seq of CREB3 in A549 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 1.5 107 A549 cells in a 15 cm dish were treated with 5 μg/mL BFA or DMSO for 24 h. Cells were crosslinked with 1% formaldehyde for 10 min and processed according to ChIP-IT® Express Enzymatic Magnetic Chromatin Immunoprecipitation Kit (Active Motif, 53009) manufacturer recommendations using an α-CREB3 antibody (Proteintech, 11275-1-AP). Chromatin inputs and eluted ChIP samples were analyzed via qPCR using the primers 5'- AGA CTC TAG ACC CCT GGT GG −3' and 5'- TTG GAG GGG GAG AGA AGA ACA −3' which flank the putative CREB3 binding site and result in a 472 bp amplification product. qPCR was carried out on a QuantStudio 7 Flex (Applied Biosystems) using SYBR green (Abclonal, RK21203).
8
Investigating CRYAA Promoter Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis was carried in HLE cells transfected with a plasmid containing the CRYAA promoter 48 hours after transfection using a ChIP-IT express Enzymatic Magnetic Chromatin Immunoprecipitation kit as per the supplier’s suggested protocol (Active Motif). Antibodies used for ChIP included: Anti-Human IgG (Abcam), and Anti-KLF10 (Proteintech). Primers used for ChIP PCR were: CRYAA ChIP F: TGGTGAGTGTAACGGAGGTTC, R: CCAGGGACCATGCTAGTTCT. CRYAA ChIP NC: F2: GAGAGCGATGGACTCTGGTC, R2: GCTGATGGAGGAAAGCAAAG.
9
Chromatin Immunoprecipitation (ChIP) Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The experiments of chromatin immunoprecipitation (ChIP) were performed using ChIP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation kit (Active Motif). Briefly, 1×106 CPCs, undifferentiated iPS cells, and differentiated iPS cells were cross-linked with 1% formaldehyde solution for 5 min at room temperature. The cells were harvested and nuclei were extracted, lysed, and enzymatically sheared to obtain chromatin. Immunoprecipitation was performed on an end-to-end rotation overnight at 4°C using the following antibodies: IgG (Upstate, Millipore 12-370), H3K4me2 (Upstate, Millipore 07-030), H3K27me3 (Upstate, Millipore 07-449), and acH3 (Upstate, Millipore 06-599). Crosslinking between DNA and proteins was reversed. DNA was purified after proteinase K digestion using Chromatin IP DNA Purification Kit (Active Motif). All precipitated DNA samples were amplified and quantitated by real-time PCR with SYBR Premix Ex Taq II (TaKaRa) and NKX2-5 ChIP primers (Table S2 in File S1 ). Signals corresponding to each antibody were normalized by respective input.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!