Sybr green kit

In line with specific protocols, the Trizol reagent was utilized to extract total RNA, which was later prepared in cDNA through reverse transcription using a reverse transcription kit. Afterwards, SYBR Green kit (Tiangen Biotechnology) and RT-PCR primer (Generay Biotech) were utilized to test cDNA in the sample. The Bio-Rad instrument was used to test the sample cyclic threshold (CT) value. With beta-actin being a reference, relative target gene level was calculated through comparing the CT value (2^− ΔCT). Primers below were utilized in the present work:
β-actin F, 5ʹ-CTACCTCATGAAGATCCTCACCGA-3ʹ;
β-actin R, 5ʹ-TTCTCCTTAATGTCACGCACGATT-3ʹ;
TYROBP F, 5ʹ-TCCTGCTGGCTGTAAGTGA-3ʹ;
TYROBP R, 5ʹ-CATCCGACCTCTGACCCT-3ʹ.

Total RNA was extracted from cultured CFs using Trizol (Ambion, USA). RNA concentration was determined by microspectrophotometer. Reverse transcription of mRNA into cDNA was performed according to the manufacturer's protocol (Tiangen, China). mRNA expression levels were quantified using a qPCR system (Fast 7500, ABI). qPCR reactions were performed with SYBR Green kit (Tiangen, China), using 1 μL of cDNA as a template in each 25 μL reaction mixture. The PCR protocol was as follows: an initial 15 min denaturation at 95°C followed by 40 cycles involving 10 s denaturation at 95°C, 30 s annealing at 60°C, and 30 s extension at 72°C. Transcription levels of migration-related factors, including vascular endothelial growth factor (VEGF), tumor necrosis factor-α (TNF-α), matrix metalloproteinase-9 (MMP-9), matrix metalloproteinase-2 (MMP-2), stem cell factor (SCF), tissue inhibitor of metalloproteinase-1 (TIMP1), epidermal growth factor (EGF), stromal cell-derived factor 1 (SDF-1), basic fibroblast growth factor (bFGF), granulocyte colony-stimulating factor (G-CSF), hepatocyte growth factor (HGF), hypoxia inducible factor-1α (HIF-1α), and monocyte chemoattractant protein-1 (MCP-1) were tested. Their primer sequences are listed in Table 1. The quantitative reactions were conducted according to the manufacture's instruction (Agilent, USA).

Total RNA was extracted using the DP432 kit (Tiangen, China) following the manufacturer’s instructions. cDNA was synthesized using the fastking cDNA dispersion RT supermax kit (Tiangen, China) with 2 µL of RNA as the template. The SYBR Green kit (Tiangen, China) was used for the fluorescence quantitative system. Primers were synthesized by Shanghai Shenggong Company. The reaction system volume was 20 µL, which contained 2 µL of cDNA solution, 10 µL of 2*SuperReal PreMix Plus, 0.6 µL of 10 µM forward and reverse primers, 0.4 µL of 50*ROX Reference Dye, and 6.4 µL of distilled deionized water. qRT-PCR analysis was performed using the LightCycler® 480 II real-time fluorescence quantitative PCR instrument. The reference gene used was Actin3 (DQ115883). The relative level of gene expression was analyzed using the 2^−∆∆Ct method. See supplementary material 3 for primers information.

Following the manufacturer’s instructions, we isolated total RNA from tissues and cells using the Trizol reagent (Invitrogen Life Technologies, USA). Subsequently, we performed cDNA synthesis using a TaqMan reverse transcription kit (KR118-03, Tiangen, Beijing, China). Quantitative real-time PCR (qRT-PCR) was performed using an SYBR Green Kit (FP205, Tiangen, Beijing, China). Primer sequences were as follows: USP28 (forward: 5′- GGACCCTTCCTTTCTCCATGA-3’; reverse: 5′-AGGCTGACTGCCTGAGTAATGTC-3′) and GAPDH (forward: 5′-CATACCAGGAAATGAGCTTGAC-3′; reverse: 5′-AACAGCGACACCCACTCCTC-3′). The relative gene expression levels were determined by the 2^–ΔΔCT using GAPDH as a reference gene.

Total RNA was obtained and quantified using spectrophotometry from mouse right brain perihematomal tissues and serum of ICH patients using TRIzol. A Prime Script RT reagent kit and an SYBR Green kit (both supplied by Tian Gen) were put to use for reversible transcription and subsequent real‐time PCR analysis. Ribo Biotechnology provided the following mouse DAXX and GAPDH primers: DAXX, forward 5’‐ACCCAGACTCCTCGTAT‐TTGC‐3′, reverse 5’‐TTCGCTGCTCTATG‐ACCCG‐3′; GAPDH, forward 5’‐GAACGGGAAGCTCA‐CTGG‐3′, reverse 5’‐GCCTGCTTCACCACCTT‐CT‐3′. Sangon Biotechnology produced the human primers DAXX and GAPDH mentioned below: DAXX, forward 5’‐ACCGCTAA‐CAGCATCATCGT‐3′, reverse 5’‐ATTTCTTGCCGCCCGAACTA‐3′; RIPK3, forward 5'‐ATCTAGAGGAGCCTCCCAGC‐3', RIPK3, reverse 5'‐GGTTGGGCCATCGAATCTGA‐3'; GAPDH, forward 5’‐GAGAAGGCTGGGGCTCATTT‐3′, reverse 5’‐AGTGATGGCATGGA‐CTGTGG‐3′.

The intracellular miRNA was extracted by miRNA extraction kit (DP501, Tiangen, Beijing, China), and reverse transcription was performed using RT-PCR kit (KR108, Tiangen). For quantitative PCR, ABI7500 real-time PCR system (Applied Biosystems, Beijing, China) was used to perform quantitative experiments using SYBR Green kit (FP201, Tiangen). The expression levels of miR-142-5p and other miRNAs were normalized by U6. The primer sequences are listed in Table 3.

We adopted Trizol reagent (Invitrogen, Thermo Fisher Scientific) for extracting total brain tissue RNA, which was further prepared reverse transcribed to cDNA using reverse transcriptase ((TIANGEN, China) in line with specific protocols. Quantitative PCR was conducted with the use of a SYBR green kit (TIANGEN, China) and a PCR machine instrument (BioRad, Singapore). The sequences of the primers used are shown below: AQP4, forward (F): CTTTCTGGAAGGCAGTCTCAG, reverse (R): CCACACCGAGCAAAACAAAGAT; MMP9, F: CTGGACAGCCAGACACTAAAG, R:CTCGCGGCAAGTCTTCAGAG; ZO-1, F: GCCGCTAAGAGCACAGCAA, R: TCCCCACTCTGAAAATGAGGA; Occludin, F: TTGAAAGTCCACCTCCTTACAGA, R: CCGGATAAAAAGAGTACGCTGG; and GAPDH, F: AGGTCGGTGTGAACGGATTTG, R: TGTAGACCATGTAGTTGAGGTCA. Finally, the gene level was analyzed using the 2^–∆∆Ct approach.