Cfx96 171 touch real time pcr detection system

To investigate the relative expression of McHB7 in the leaves of ice plant under high salinity conditions, one-month-old ice plant seedlings were irrigated with 50 mL 500 mM NaCl solution each day for 14 days. The second pair of leaves were harvested and midveins discarded for RNA extraction. Each sample has four biological replicates and three technical replicates. Plasma membrane intrinsic protein 1; 2 (McPIP1; 2) was used as the internal reference. The 2× SYBR Green qPCR Master Mix kit (Bimake, Houston, TX, USA) was used for RT-qPCR using a CFX96 171 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Real-time primers are listed in Supplemental Table S1. The relative expression in different samples was calculated using the 2^−ΔΔCt method [64 (link)]. Based on Student’s t-test, bars in the figures correspond to standard deviation. A star indicates p-value < 0.05, two stars indicate p-value < 0.01, and three stars indicate p-value < 0.001.

Total RNA was extracted from five-week-old plant leaves with an RNeasy Plant Mini Kit (QIAGEN, Germantown, MD, USA). A PrimeScript RT reagent Kit (New England Biolabs, Ipswich, MA, USA) was used for cDNA synthesis. A DreamTaq PCR Master Mix (2X) (Thermo Scientific, CA, USA) was used for qRT-PCR with a CFX96 171 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). ACTIN2 was used as the internal reference. The primers were: MPK4 F: TGCTCTGAATACACAGCAGC, MPK4 R: CACACTGAGTCTTGAGGATTG; ACTIN2 F: CGTACAACCGGTATTGTGCTG, ACTIN2 R: AGTAAGGTCACGTCCAGCAAG. The PCR products were run through 1% agarose gel with 0.2 μg/mL ethidium bromide under 110 V for 30 min. A 100 bp DNA Ladder (NEB N3231S) was used as a size indicator.