The sequences of all miRNAs were obtained from miRBase (http://www.mirbase.org/ ), and the optimized pre-miR-34a as well as anti-miR-21, NRF2-siRNA, let-7c, and miR-124 sequences were adopted from our recently study (Ho et al. 2018 (link); Li et al. 2018 (link)). CO-BERA sequences (Table 1 ) were generated by substituting miR-34a duplexes with target miRNA or siRNA sequences, as illustrated in Fig. 1a , and corresponding coding sequences were synthesized in the pUC57 vector by GenScript Corporation (Piscataway, NJ). Target inserts were released from the plasmids after digestion with EcoRI and PstI (New England Biolabs, Ipswich, MA). Following gel purification using USB PrepEase Gel Extraction Kit (Affymetrix, Inc. Cleveland, OH), each insert was ligated to the EcoRI- and PstI-digested vector pBSTNAV (Ho et al. 2018 (link); Ponchon et al. 2009 (link)) with T4 Rapid Ligation Kit (Thermo Fisher Scientific). The plasmids were then transformed into DH5α competent cells and selected with ampicillin. Colonies were expanded, and CO-BERA expression plasmids were isolated with a Miniprep Kit (Qiagen, Hilden, Germany). All target CO-BERA expression plasmids were confirmed by sequencing analysis (GenScript, Piscataway, NJ).
Usb prepease gel extraction kit
Manufactured by Thermo Fisher Scientific
The USB PrepEase Gel Extraction Kit is a laboratory instrument designed to efficiently extract and purify DNA fragments from agarose gels. It utilizes a simple and straightforward protocol to isolate DNA of interest from gel slices, enabling users to obtain high-quality DNA samples for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Miniprep kit, by Qiagen (1 mentions)
T4 rapid ligation kit, by Thermo Fisher Scientific (1 mentions)
Ecori, by New England Biolabs (1 mentions)
Puc57 vector, by GenScript (1 mentions)
Axioskop microscope, by Zeiss (1 mentions)
Axiocam 105 color digital camera, by Zeiss (1 mentions)
Dig rna labeling kit, by Roche (1 mentions)
2 protocols using usb prepease gel extraction kit
1
Optimized miRNA and siRNA Plasmid Construction
2
In Situ Hybridization of Klhl14-AS in Mouse Thyroid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Organs were fixed in 4% PFA (overnight, 4°C), washed in saline solution, dehydrated in solutions at increasing ethanol concentration from 70% to 100% (overnight, 4°C), and paraffin-embedded at 60°C after xylene soaking. The period of each step is determined according to the size of the processed sample.
Paraffin-embedded samples were sliced in 7 μm sections and analyzed. To perform the in situ hybridization, the sections were deparaffinized in xylene and rehydrated with EtOH 100% to EtOH 50%. After rehydration, the hybridization was performed as described in Fagman et al. [21 (link)], using a specific probe for Klhl14-AS amplified with Pwo SuperYield DNA Polymerase from adult mouse thyroid cDNA using the following oligos—Klhl14-AS sp6: GGCTGAACAGGAAGGGACCCT and Klhl14-AS T7: CAGATCACAGCTAAGAAAAAAGC.
PCR product was purified using the USB® PrepEase® Gel Extraction Kit (Affymetrix 78756). Digoxigenin-labelled riboprobes (sense and antisense) were obtained using the DIG-labeling RNA kit (Roche Diagnostics Basel, Switzerland) following the manufacturer's instructions. No signal was detected with the sense riboprobes (not shown). Images were obtained using an Axioskop microscope equipped with an Axiocam 105 color digital camera (Zeiss, Oberkochen, Germany). Images were processed using the Axion Vision software.
Paraffin-embedded samples were sliced in 7 μm sections and analyzed. To perform the in situ hybridization, the sections were deparaffinized in xylene and rehydrated with EtOH 100% to EtOH 50%. After rehydration, the hybridization was performed as described in Fagman et al. [21 (link)], using a specific probe for Klhl14-AS amplified with Pwo SuperYield DNA Polymerase from adult mouse thyroid cDNA using the following oligos—Klhl14-AS sp6: GGCTGAACAGGAAGGGACCCT and Klhl14-AS T7: CAGATCACAGCTAAGAAAAAAGC.
PCR product was purified using the USB® PrepEase® Gel Extraction Kit (Affymetrix 78756). Digoxigenin-labelled riboprobes (sense and antisense) were obtained using the DIG-labeling RNA kit (Roche Diagnostics Basel, Switzerland) following the manufacturer's instructions. No signal was detected with the sense riboprobes (not shown). Images were obtained using an Axioskop microscope equipped with an Axiocam 105 color digital camera (Zeiss, Oberkochen, Germany). Images were processed using the Axion Vision software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!