For the overexpression of SIRT 1 in PANC-1 or BxPC-3 cells, the SIRT 1 coding sequence was amplified and was cloned into pLenti6/TR vector (Invitrogen, Carlsbad, CA, USA). The recombinant virus of pLenti-SIRT 1 or control pLentivirus (pLenti-Con) was produced by cotransfecting 293T cells with pLenti-SIRT 1 or pLenti-Con and ViraSafe™ Lentiviral Packaging System (Cell Biolabs, San Diego, CA, USA). We used pLenti-SIRT 1 or pLenti-Con virus with 5 MOI (multiplicity of infection) to infect PANC-1 or BxPC-3 cells for 0 or 24 hours. To knockdown the SIRT 1 expression in PANC-1 cells, 30 or 60 nM SIRT 1-specific siRNA (siRNA-SIRT 1) or the scramble siRNA (siRNA-Con) (Genscript, Nanjing, China) was transfected with INTERFERin siRNA transfection reagent (Polyplus-Transfection Inc., San Marcos, CA, USA) into the PANC-1 or BxPC-3 cells with more than 85% confluence to abrogate the SIRT 1 expression.
Virasafe lentiviral packaging system
Manufactured by Cell Biolabs
Sourced in United States
The ViraSafe™ Lentiviral Packaging System is a set of plasmids designed for the production of replication-incompetent lentiviral particles. The system includes vectors for expressing the necessary lentiviral packaging proteins and a vector for cloning the gene of interest.
Automatically generated - may contain errors
Lab products found in correlation
Transdux max, by System Biosciences (3 mentions)
Plenti6 tr vector, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Interferin sirna transfection reagent, by Polyplus Transfection (1 mentions)
Viraductin, by Cell Biolabs (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Luciferase activity assay kit, by Promega (1 mentions)
Lenti x gostix plus, by Takara Bio (1 mentions)
Xl 10 gold e coli, by Agilent Technologies (1 mentions)
Mission shrna library, by Merck Group (1 mentions)
8 protocols using virasafe lentiviral packaging system
1
SIRT1 Overexpression and Knockdown in Pancreatic Cancer Cells
2
HMGB1 and Beclin1 Modulation in PC12 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To promote the HMGB1 level in PC12 (Synwt) or PC12 (Synmt) cells, the coding sequence of HMGB1 or the coding sequence of Red Fluorescence Protein (RFP) was cloned into the pcDNA3.1(+) vector. And 5 μg/mL (to guarantee more than 90 % cells to be transfected) HMGB1-pcDNA3.1(+) or RFP-pcDNA3.1(+) plasmid was transfected into 105 per well 85 % confluent PC12 (Synwt) or PC12 (Synmt) cells. To upregulate the Beclin1 level in PC12 cells, Beclin1 or the coding sequence of Chloramphenicol acetyl transferase(CAT) was amplified and was cloned into the pLenti 6/TR vector (Invitrogen, Carlsbad, CA, USA). Recombinant pLenti-Beclin1 (LV-Beclin1) or pLenti-CAT virus of (LV-Con) was produced by cotransfecting 293 T cells with pLenti-Beclin1 or pLenti-CAT and ViraSafe™ Lentiviral Packaging System (Cell Biolabs, San Diego, CA, USA). PC12 (Synwt) or PC12 (Synmt) cells were infected with LV-Beclin1 or LV-Con virus with 1 Multiplicity of infection (MOI) for 12 or 24 hours.
3
Genetic Manipulation of NQO1 and Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transduced using the ViraSafe Lentiviral Packaging System (Cell Biolabs). The dCas9–KRAB and SunTag–VP64 systems were used for CRISPRi and CRISPRa, respectively, as described previously61 (link). NQO1 was silenced both with short hairpin RNA (shRNA) and with CRISPRi constructs. NQO1-AS and HNRNPC were similarly silenced using CRISPRi. CTCF and HNRNPA2B1 were silenced using small interfering RNA (siRNA). NQO1 and NQO1-AS were overexpressed using CRISPRa. The shRNA and guide RNA sequences are shown in Supplementary Table 1 .
4
Lentiviral Transduction of Peritoneal Metastatic Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forty thousand 293FT cells with 10 ml of DMEM supplied with 10% of FBS and 1% of penicillin streptomycin were seeded on a 100 pi tissue culture dish. After incubating for 24 hours at 37°C and 5% CO2, the culture medium was changed to 10 ml of Opti-MEM, and short hairpin RNA targeting CNN3 and control vector were treated using ViraSafe Lentiviral Packaging System, Pantropic (CELL BIOLABS, INC., San Diego, CA), and Lipofectamine 3000 (Invitrogen) in accordance with manufacturer’s protocol. After 48 hours, the viral soup was harvested and filtered through a 0.45-μm pored filter (Sartorius Stedim Biotech SA, Göttingen, Germany). The harvested viral soup was aliquoted into a 1.5-ml tube and kept at −70°C. Fifty thousand peritoneal metastatic cells were seeded on 24-well tissue culture plate with 0.5 ml of RPMI1460 medium and incubated at 37°C in an atmosphere of 5% CO2 and 95% air for 24 hours. Viral transduction was performed using ViraDuctin (CELL BIOLABS, INC., San Diego, CA) according to manufacturer’s protocol.
5
Luciferase-Labeled Tumor Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The firefly luciferase gene was cloned into the pSMPUW-Hygro Lentiviral Vector (Cell Biolabs, catalog number: VPK-214). Lentiviruses containing a luciferase expression cassette were produced in 293 TN cells (System Bioscience, catalog number: LV900A-1) by transient transfection of the pSMPUW-Hygro Lentiviral Vector carrying the luciferase gene and the ViraSafe™ Lentiviral Packaging System (Cell Biolabs, catalog number: VPK-206) with Lipofectamine 2000 (Thermo Fisher Scientific, catalog number: 11668030). The recombinant lentivirus titer was measured using Lenti-X™ GoStix™ Plus (ClonTech, catalog number: 631280). E0771 and 4T1 cells were transduced with lentiviral vectors carrying the luciferase expression cassette with TransDux MAX™ (System Bioscience, catalog number: LV860A-1). Luciferase-labeled E0771 and 4T1 cells were then selected in the presence of 300 µg/ml hygromycin. Luciferase gene expression in E0771 and 4T1 cells was validated using a luciferase activity assay kit (Promega, catalog number: E4550). Luciferase-labeled E0771 and 4T1 cells were maintained in RPMI 1640 medium supplemented with 10% FBS, penicillin/streptomycin, and 300 µg/ml hygromycin.
6
Lentiviral-Mediated Knockdown and Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral particles were created using the ViraSafe lentiviral packaging system (Cell Biolabs). ShRNA oligo sequences were based upon the Sigma-Aldrich MISSION shRNA library and were obtained from Integrated DNA technologies. The following shRNAs were used in this study: PCK1 sh3 (TRCN0000196706), PCK1 sh4 (TRCN0000199286), PCK1 sh5 (TRCN0000199573), shControl (SHC002), mouse PCK1 sh64 (TRCN0000025064), mouse PCK1 sh66 (TRCN0000025066), DHODH sh2 (TRCN0000221421), and DHODH sh3 (TRCN0000221422). Forward and reverse complement oligos were annealed, cloned into pLKO, and transformed into XL10-Gold E. coli (200314, Agilent). For PCK1 overexpression, PCK1 cDNA (plasmid ID HsCD00045535) was obtained from the PlasmID Repository at Harvard Medical School and cloned into pBabe-puromycin or plx304-blasticidin. For tetracycline-inducible experiments, the seed sequences of shRNA control (SHC002) or PCK1 sh4 (TRCN0000199286) were cloned into pLKO-Tet-On (Wiederschain et al., 2009 (link)). All plasmids were isolated using the plasmid plus midi kit (Qiagen). Transduction and transfection were performed as described previously (Yu et al., 2015 (link)).
7
Lentiviral Transduction of Hematopoietic Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pLenti-GFP Lentiviral Control Vector (#LTV-400) and related products were obtained from Cell Biolabs Inc. The lentiviral supernatant was produced by cotransfecting 293 T cells (#LTV-100) with the pLenti-GFP and ViraSafe™ Lentiviral Packaging System (#VPK-206). The lentivirus was concentrated and purified using the ViraBind™ Lentivirus Concentration and Purification Kit (#VPK-090), and the virus was used to infect isolated HSCs using the ViraDuctin™ Lentivirus Transduction Kit (#LTV-200).
8
RBMS1 Knockdown and Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RBMS1 knockdown cells were using the ViraSafe lentiviral packaging system (Cell Biolabs). shRNA plasmids were obtained from the Sigma-Aldrich TRC library. RBMS1: TRCN0000074936 (sh1), TRCN0000074937 (sh3), and TRCN0000291051 (sh2). AKAP12 and SDCBP were silenced using CRISPR-interference constructs by expressing the following sgRNAs: GGGCGCTCTCGGGACCTCGC and GGCGGCGAGCGGTTCCTTGT. RBMS1 overexpression cells were generated by stably transducing cells with the pLX-304 lentiviral vector containing the RBMS1 open reading frame.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!